Rmu_sc0005329.1_g000004

Domain of unknown function (DUF4228)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005329.1
Physical Location & Seq
Forward (+)
31900 .. 33150
1251 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005329.1_g000004.1.cds

Sequence Viewer

Length: 657 bp
atgggaaattgccaagccatagatgcagcaactttggtgatacaacacccaaatgggaaggtcgagaagttctatggggcagtgagtgctagtgaggtcatgaagatgaaccctggtcactatgttgctcttctcatctccaccacactctgtccctcatcaaatcccaaatccaaaaccaatggtcctgataataatgctggtgatgatcatgatcacaagaattctgatatgaccaatgagaagaagactggttctagtactggttcagttcgaatcacacgcatcaagcttctcaggccaactgatactcttgttctcggccaagtttacagactcatcaccactcaagaggttatgaagggtctgtgggcaaagaaacaagcaaaggggaagagatcaaaccagtttgagccactaacagcagagaggttgcagagagagacagtagcagcagcagctagcagaagatctgaggctgcttctgagctggacaaggacaacaaccaggtgatgactaaaactgatagacaccaccaccgacctagaacatcaacctcatcgtcagggagcactagtagtagtcagtctgccgcaacagctcgaccaagaacatggcaaccttcactgcaaagcatctcagaagctgcgagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

218

Amino Acids

23.68

Weight (kDa)

9.79

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012810)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 594
AcoI YGGCCR 1 cut(s) 322
AcsI RAATTY 1 cut(s) 223
AfaI GTAC 1 cut(s) 262
AhlI ACTAGT 1 cut(s) 575
AjnI CCWGG 2 cut(s) 112, 507
AluBI AGCT 6 cut(s) 292, 461, 490, 602, 647, 654
AluI AGCT 6 cut(s) 292, 461, 490, 602, 647, 654
Alw21I GWGCWC 1 cut(s) 575
Alw26I GTCTC 1 cut(s) 437
AlwNI CAGNNNCTG 1 cut(s) 647
AoxI GGCC 2 cut(s) 299, 322
ApeKI GCWGC 6 cut(s) 26, 452, 455, 458, 479, 647
ApoI RAATTY 1 cut(s) 223
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 4 cut(s) 49, 215, 334, 523
AsuII TTCGAA 1 cut(s) 274
AsuNHI GCTAGC 1 cut(s) 461
AvaII GGWCC 1 cut(s) 185
BaeI ACNNNNGTAYC 2 cut(s) 300, 333
BbsI GAAGAC 1 cut(s) 254
Bbv12I GWGCWC 1 cut(s) 575
BbvI GCAGC 6 cut(s) 38, 464, 466, 467, 470, 634
BciT130I CCWGG 2 cut(s) 114, 509
BclI TGATCA 2 cut(s) 208, 214
BcoDI GTCTC 1 cut(s) 437
BcuI ACTAGT 1 cut(s) 575
BfaI CTAG 5 cut(s) 90, 258, 462, 546, 576
BglII AGATCT 1 cut(s) 470
BisI GCNGC 7 cut(s) 27, 453, 456, 459, 480, 594, 648
BlsI GCNGC 7 cut(s) 28, 454, 457, 460, 481, 595, 649
BmcAI AGTACT 1 cut(s) 262
Bme1390I CCNGG 2 cut(s) 114, 509
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmrFI CCNGG 2 cut(s) 114, 509
BmsI GCATC 3 cut(s) 13, 294, 645
BmtI GCTAGC 1 cut(s) 465
BpiI GAAGAC 1 cut(s) 254
Bpu14I TTCGAA 1 cut(s) 274
BpuEI CTTGAG 1 cut(s) 333
BsaBI GATNNNNATC 1 cut(s) 213
BsaJI CCNNGG 1 cut(s) 112
BsaXI ACNNNNNCTCC 2 cut(s) 562, 592
Bse1I ACTGG 3 cut(s) 256, 268, 406
Bse8I GATNNNNATC 1 cut(s) 213
BseBI CCWGG 2 cut(s) 114, 509
BseDI CCNNGG 1 cut(s) 112
BseJI GATNNNNATC 1 cut(s) 213
BseMII CTCAG 4 cut(s) 310, 465, 477, 654
BseNI ACTGG 3 cut(s) 256, 268, 406
BseXI GCAGC 6 cut(s) 38, 464, 466, 467, 470, 634
BshFI GGCC 2 cut(s) 301, 324
BsiHKAI GWGCWC 1 cut(s) 575
BslFI GGGAC 1 cut(s) 138
BsmAI GTCTC 1 cut(s) 437
BsmFI GGGAC 1 cut(s) 138
BsnI GGCC 2 cut(s) 301, 324
Bsp119I TTCGAA 1 cut(s) 274
Bsp1286I GDGCHC 1 cut(s) 575
Bsp143I GATC 4 cut(s) 208, 214, 398, 470
BspACI CCGC 1 cut(s) 594
BspANI GGCC 2 cut(s) 301, 324
BspCNI CTCAG 4 cut(s) 309, 466, 478, 653
BspHI TCATGA 2 cut(s) 99, 211
BspOI GCTAGC 1 cut(s) 465
BspQI GCTCTTC 1 cut(s) 135
BspT104I TTCGAA 1 cut(s) 274
BsrI ACTGG 3 cut(s) 256, 268, 406
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 4 cut(s) 208, 214, 398, 470
Bst2UI CCWGG 2 cut(s) 114, 509
Bst4CI ACNGT 1 cut(s) 448
Bst6I CTCTTC 2 cut(s) 135, 389
BstAPI GCANNNNNTGC 1 cut(s) 86
BstBI TTCGAA 1 cut(s) 274
BstC8I GCNNGC 2 cut(s) 463, 652
BstDEI CTNAG 4 cut(s) 296, 474, 486, 640
BstKTI GATC 4 cut(s) 211, 217, 401, 473
BstMAI GTCTC 1 cut(s) 437
BstMBI GATC 4 cut(s) 208, 214, 398, 470
BstMWI GCNNNNNNNGC 5 cut(s) 23, 86, 298, 458, 599
BstNI CCWGG 2 cut(s) 114, 509
BstSCI CCNGG 2 cut(s) 112, 507
BstV1I GCAGC 6 cut(s) 38, 464, 466, 467, 470, 634
BstV2I GAAGAC 1 cut(s) 254
BstX2I RGATCY 1 cut(s) 470
BstXI CCANNNNNNTGG 1 cut(s) 615
BstYI RGATCY 1 cut(s) 470
BsuRI GGCC 2 cut(s) 301, 324
BtsI GCAGTG 2 cut(s) 87, 626
BtsIMutI CAGTG 2 cut(s) 87, 626
Cac8I GCNNGC 2 cut(s) 463, 652
CaiI CAGNNNCTG 1 cut(s) 647
CciI TCATGA 2 cut(s) 99, 211
Cfr13I GGNCC 1 cut(s) 185
CsiI ACCWGGT 1 cut(s) 507
Csp6I GTAC 1 cut(s) 261
CviAII CATG 3 cut(s) 100, 212, 615
CviQI GTAC 1 cut(s) 261
DdeI CTNAG 4 cut(s) 296, 474, 486, 640
DpnI GATC 4 cut(s) 210, 216, 400, 472
DpnII GATC 4 cut(s) 208, 214, 398, 470
EaeI YGGCCR 1 cut(s) 322
Eam1104I CTCTTC 2 cut(s) 135, 389
EarI CTCTTC 2 cut(s) 135, 389
Eco47I GGWCC 1 cut(s) 185
EcoRI GAATTC 1 cut(s) 223
EcoRII CCWGG 2 cut(s) 112, 507
FaeI CATG 3 cut(s) 103, 215, 618
FaiI YATR 8 cut(s) 20, 75, 101, 123, 213, 233, 359, 616
FaqI GGGAC 1 cut(s) 138
FatI CATG 3 cut(s) 99, 211, 614
FbaI TGATCA 2 cut(s) 208, 214
Fnu4HI GCNGC 7 cut(s) 27, 453, 456, 459, 480, 594, 648
Fsp4HI GCNGC 7 cut(s) 27, 453, 456, 459, 480, 594, 648
FspBI CTAG 5 cut(s) 90, 258, 462, 546, 576
GluI GCNGC 7 cut(s) 27, 453, 456, 459, 480, 594, 648
HaeIII GGCC 2 cut(s) 301, 324
Hin1II CATG 3 cut(s) 103, 215, 618
HindIII AAGCTT 1 cut(s) 290
HinfI GANTC 2 cut(s) 276, 336
HphI GGTGA 4 cut(s) 49, 215, 334, 523
Hpy166II GTNNAC 1 cut(s) 331
Hpy188I TCNGA 4 cut(s) 229, 475, 487, 643
Hpy188III TCNNGA 5 cut(s) 64, 100, 188, 212, 350
Hpy8I GTNNAC 1 cut(s) 331
HpyAV CCTTC 3 cut(s) 52, 355, 633
HpyCH4III ACNGT 1 cut(s) 448
HpyCH4V TGCA 3 cut(s) 26, 436, 631
HpyF10VI GCNNNNNNNGC 5 cut(s) 23, 86, 298, 458, 599
HpyF3I CTNAG 4 cut(s) 296, 474, 486, 640
Hsp92II CATG 3 cut(s) 103, 215, 618
Ksp22I TGATCA 2 cut(s) 208, 214
Kzo9I GATC 4 cut(s) 208, 214, 398, 470
LguI GCTCTTC 1 cut(s) 135
LmnI GCTCC 1 cut(s) 570
Lsp1109I GCAGC 6 cut(s) 38, 464, 466, 467, 470, 634
LweI GCATC 3 cut(s) 13, 294, 645
MabI ACCWGGT 1 cut(s) 507
MaeI CTAG 5 cut(s) 90, 258, 462, 546, 576
MaeIII GTNAC 1 cut(s) 116
MalI GATC 4 cut(s) 210, 216, 400, 472
MboI GATC 4 cut(s) 208, 214, 398, 470
MboII GAAGA 6 cut(s) 115, 122, 256, 259, 406, 480
MflI RGATCY 1 cut(s) 470
MhlI GDGCHC 1 cut(s) 575
MluCI AATT 2 cut(s) 7, 223
MlyI GAGTC 1 cut(s) 330
MnlI CCTC 6 cut(s) 88, 166, 346, 423, 469, 568
MslI CAYNNNNRTG 2 cut(s) 51, 104
MspR9I CCNGG 2 cut(s) 114, 509
MvaI CCWGG 2 cut(s) 114, 509
MwoI GCNNNNNNNGC 5 cut(s) 23, 86, 298, 458, 599
NdeII GATC 4 cut(s) 208, 214, 398, 470
NheI GCTAGC 1 cut(s) 461
NlaIII CATG 3 cut(s) 103, 215, 618
NmeAIII GCCGAG 1 cut(s) 300
NmuCI GTSAC 1 cut(s) 116
NspV TTCGAA 1 cut(s) 274
PagI TCATGA 2 cut(s) 99, 211
PciSI GCTCTTC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 276
PkrI GCNGC 7 cut(s) 28, 454, 457, 460, 481, 595, 649
PleI GAGTC 1 cut(s) 330
PpsI GAGTC 1 cut(s) 330
Psp6I CCWGG 2 cut(s) 112, 507
PspGI CCWGG 2 cut(s) 112, 507
PspPI GGNCC 1 cut(s) 185
PstNI CAGNNNCTG 1 cut(s) 647
PsuI RGATCY 1 cut(s) 470
RsaI GTAC 1 cut(s) 262
RsaNI GTAC 1 cut(s) 261
RseI CAYNNNNRTG 2 cut(s) 51, 104
SapI GCTCTTC 1 cut(s) 135
SatI GCNGC 7 cut(s) 27, 453, 456, 459, 480, 594, 648
Sau3AI GATC 4 cut(s) 208, 214, 398, 470
Sau96I GGNCC 1 cut(s) 185
ScaI AGTACT 1 cut(s) 262
SchI GAGTC 1 cut(s) 330
ScrFI CCNGG 2 cut(s) 114, 509
SduI GDGCHC 1 cut(s) 575
SexAI ACCWGGT 1 cut(s) 507
SfaNI GCATC 3 cut(s) 13, 294, 645
SfuI TTCGAA 1 cut(s) 274
SinI GGWCC 1 cut(s) 185
SmiMI CAYNNNNRTG 2 cut(s) 51, 104
SmlI CTYRAG 1 cut(s) 348
SmoI CTYRAG 1 cut(s) 348
SpeI ACTAGT 1 cut(s) 575
Sse9I AATT 2 cut(s) 7, 223
SsiI CCGC 1 cut(s) 594
SspMI CTAG 5 cut(s) 90, 258, 462, 546, 576
StyD4I CCNGG 2 cut(s) 112, 507
TaaI ACNGT 1 cut(s) 448
TaqI TCGA 3 cut(s) 63, 274, 604
TasI AATT 2 cut(s) 7, 223
TatI WGTACW 1 cut(s) 260
TauI GCSGC 1 cut(s) 596
TfiI GAWTC 1 cut(s) 276
TscAI CASTG 2 cut(s) 87, 633
TseFI GTSAC 1 cut(s) 116
TseI GCWGC 6 cut(s) 26, 452, 455, 458, 479, 647
Tsp45I GTSAC 1 cut(s) 116
TspDTI ATGAA 3 cut(s) 116, 122, 374
TspRI CASTG 2 cut(s) 87, 633
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 1 cut(s) 223
XspI CTAG 5 cut(s) 90, 258, 462, 546, 576
ZrmI AGTACT 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.