Rmu_sc0005969.1_g000016

Ring finger domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005969.1
OG0017317
Physical Location & Seq
Reverse (-)
42799 .. 44022
1224 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005969.1_g000016.1.cds

Sequence Viewer

Length: 759 bp
atgagtagtccgagtccctggcaggatgatgaaatggaaagttcgagcatggatgagcagtgtgattccaggatgtttaactggtgtgaagtgatgcaaacagaagtacatgagggaccctatccgccaacatcacaatgctacgacttgctgatcagattaacagtcctcatgcaagcgggggcttttatgatagacaccaatccaccacattcttttatttataattttctgaaggaaccaggtatattaggggaatcaaagatttgggtcaacttcacctctatagacaaacaacatcagagcctgaaggacttgatgttttcgctttgtttcatgggcgttgagcaaaaagactgccgagatattgctgtagaaatattaaataaagttcaaccggccatcccccttccccagttggctattgatgtgaccgtaaggctcatgtgttctgaattgtatggaagatttgacggttttgatgatatgcgcttgtatctctatgcaaagaaatcatgggacgaccatagggctgctactacctcctgcactggttctcatatgcctccatcatcatgtgctgtttgtttggaggattttggaggtggagttgatgctaaaatgattgctcgtttgccctgcttacattattttcatgcagcttgcactgcccagtgggggggggaagaaaagtctgtcttagaaggatcgatcatctatgtgtcacagaaggatcgatcatctatgtgtgttaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-RING_2

Protein Analysis

252

Amino Acids

28.45

Weight (kDa)

4.81

Isoelectric Point (pI)

53.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017317)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g00591 FvH4_6g00620
rosa_chinensis RchiOBHm_Chr3g0447991 RchiOBHm_Chr3g0448031
rosa_laevigata RLG00000025954
rosa_multiflora Rmu_sc0005969.1_g000012 Rmu_sc0005969.1_g000016
rosa_roxburghii Rroxscaffold_6G00426400
rosa_samantha Rh3AG007300 Rh3CG007100 Rh3DG007500
rosa_wichuraiana Rw0G020030 Rw3G000570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 225
AciI CCGC 2 cut(s) 125, 179
AclWI GGATC 2 cut(s) 715, 741
AcoI YGGCCR 1 cut(s) 399
AcuI CTGAAG 2 cut(s) 254, 329
AfaI GTAC 1 cut(s) 108
AfiI CCNNNNNNNGG 2 cut(s) 678, 679
AgsI TTSAA 1 cut(s) 395
AjnI CCWGG 3 cut(s) 17, 68, 241
AluBI AGCT 1 cut(s) 662
AluI AGCT 1 cut(s) 662
AlwI GGATC 2 cut(s) 715, 741
AlwNI CAGNNNCTG 1 cut(s) 307
AoxI GGCC 1 cut(s) 399
ApeKI GCWGC 2 cut(s) 533, 659
AspLEI GCGC 1 cut(s) 492
AspS9I GGNCC 1 cut(s) 116
AsuHPI GGTGA 1 cut(s) 271
AvaII GGWCC 1 cut(s) 116
BbvI GCAGC 2 cut(s) 520, 671
BccI CCATC 2 cut(s) 410, 577
BciT130I CCWGG 3 cut(s) 19, 70, 243
BclI TGATCA 1 cut(s) 153
BfmI CTRYAG 2 cut(s) 285, 372
BisI GCNGC 2 cut(s) 534, 660
BlsI GCNGC 2 cut(s) 535, 661
Bme1390I CCNGG 3 cut(s) 19, 70, 243
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmiI GGNNCC 3 cut(s) 117, 118, 240
BmrFI CCNGG 3 cut(s) 19, 70, 243
BmrI ACTGGG 2 cut(s) 409, 667
BmsI GCATC 2 cut(s) 84, 604
BmuI ACTGGG 2 cut(s) 409, 667
Bsa29I ATCGAT 2 cut(s) 710, 736
BsaJI CCNNGG 1 cut(s) 17
BsaXI ACNNNNNCTCC 2 cut(s) 594, 624
Bsc4I CCNNNNNNNGG 2 cut(s) 678, 679
Bse118I RCCGGY 1 cut(s) 397
Bse1I ACTGG 4 cut(s) 86, 415, 556, 673
BseBI CCWGG 3 cut(s) 19, 70, 243
BseCI ATCGAT 2 cut(s) 710, 736
BseDI CCNNGG 1 cut(s) 17
BseGI GGATG 4 cut(s) 31, 58, 78, 402
BseLI CCNNNNNNNGG 2 cut(s) 678, 679
BseNI ACTGG 4 cut(s) 86, 415, 556, 673
BseXI GCAGC 2 cut(s) 520, 671
BsgI GTGCAG 1 cut(s) 532
BshFI GGCC 1 cut(s) 401
BshVI ATCGAT 2 cut(s) 710, 736
BsiSI CCGG 1 cut(s) 398
BslFI GGGAC 2 cut(s) 129, 533
BslI CCNNNNNNNGG 2 cut(s) 678, 679
BsmFI GGGAC 2 cut(s) 129, 533
BsnI GGCC 1 cut(s) 401
Bsp143I GATC 5 cut(s) 153, 707, 711, 733, 737
BspACI CCGC 2 cut(s) 125, 179
BspANI GGCC 1 cut(s) 401
BspDI ATCGAT 2 cut(s) 710, 736
BspLI GGNNCC 3 cut(s) 117, 118, 240
BspPI GGATC 2 cut(s) 715, 741
BsrFI RCCGGY 1 cut(s) 397
BsrI ACTGG 4 cut(s) 86, 415, 556, 673
BssAI RCCGGY 1 cut(s) 397
BssECI CCNNGG 1 cut(s) 17
BssMI GATC 5 cut(s) 153, 707, 711, 733, 737
Bst2UI CCWGG 3 cut(s) 19, 70, 243
Bst4CI ACNGT 3 cut(s) 166, 436, 476
BstC8I GCNNGC 2 cut(s) 177, 664
BstDEI CTNAG 1 cut(s) 700
BstF5I GGATG 4 cut(s) 31, 58, 78, 402
BstHHI GCGC 1 cut(s) 492
BstKTI GATC 5 cut(s) 156, 710, 714, 736, 740
BstMBI GATC 5 cut(s) 153, 707, 711, 733, 737
BstMWI GCNNNNNNNGC 1 cut(s) 668
BstNI CCWGG 3 cut(s) 19, 70, 243
BstSCI CCNGG 3 cut(s) 17, 68, 241
BstSFI CTRYAG 2 cut(s) 285, 372
BstV1I GCAGC 2 cut(s) 520, 671
Bsu15I ATCGAT 2 cut(s) 710, 736
BsuRI GGCC 1 cut(s) 401
BsuTUI ATCGAT 2 cut(s) 710, 736
BtsCI GGATG 4 cut(s) 31, 58, 78, 402
BtsI GCAGTG 2 cut(s) 65, 666
BtsIMutI CAGTG 4 cut(s) 65, 549, 666, 680
Cac8I GCNNGC 2 cut(s) 177, 664
CaiI CAGNNNCTG 1 cut(s) 307
CfoI GCGC 1 cut(s) 492
Cfr10I RCCGGY 1 cut(s) 397
Cfr13I GGNCC 1 cut(s) 116
ClaI ATCGAT 2 cut(s) 710, 736
CsiI ACCWGGT 1 cut(s) 241
Csp6I GTAC 1 cut(s) 107
CviAII CATG 8 cut(s) 49, 110, 172, 337, 445, 516, 576, 656
CviJI RGCY 7 cut(s) 185, 306, 401, 422, 442, 533, 662
CviKI_1 RGCY 7 cut(s) 185, 306, 401, 422, 442, 533, 662
CviQI GTAC 1 cut(s) 107
DdeI CTNAG 1 cut(s) 700
DpnI GATC 5 cut(s) 155, 709, 713, 735, 739
DpnII GATC 5 cut(s) 153, 707, 711, 733, 737
EaeI YGGCCR 1 cut(s) 399
EciI GGCGGA 1 cut(s) 114
Eco47I GGWCC 1 cut(s) 116
Eco57I CTGAAG 2 cut(s) 254, 329
EcoO109I RGGNCCY 1 cut(s) 116
EcoRII CCWGG 3 cut(s) 17, 68, 241
FaeI CATG 8 cut(s) 52, 113, 175, 340, 448, 519, 579, 659
FalI AAGNNNNNCTT 2 cut(s) 683, 715
FaqI GGGAC 2 cut(s) 129, 533
FatI CATG 8 cut(s) 48, 109, 171, 336, 444, 515, 575, 655
FauI CCCGC 1 cut(s) 172
FauNDI CATATG 1 cut(s) 561
FbaI TGATCA 1 cut(s) 153
Fnu4HI GCNGC 2 cut(s) 534, 660
FokI GGATG 4 cut(s) 38, 65, 85, 389
Fsp4HI GCNGC 2 cut(s) 534, 660
GlaI GCGC 1 cut(s) 491
GluI GCNGC 2 cut(s) 534, 660
HaeIII GGCC 1 cut(s) 401
HapII CCGG 1 cut(s) 398
HhaI GCGC 1 cut(s) 492
Hin1II CATG 8 cut(s) 52, 113, 175, 340, 448, 519, 579, 659
Hin6I GCGC 1 cut(s) 490
HinP1I GCGC 1 cut(s) 490
HincII GTYRAC 1 cut(s) 274
HindII GTYRAC 1 cut(s) 274
HinfI GANTC 3 cut(s) 13, 65, 257
HpaII CCGG 1 cut(s) 398
HphI GGTGA 1 cut(s) 271
Hpy166II GTNNAC 1 cut(s) 274
Hpy188I TCNGA 5 cut(s) 12, 158, 234, 303, 454
Hpy8I GTNNAC 1 cut(s) 274
HpyAV CCTTC 5 cut(s) 229, 304, 419, 698, 724
HpyCH4III ACNGT 3 cut(s) 166, 436, 476
HpyCH4V TGCA 6 cut(s) 97, 175, 506, 549, 659, 666
HpyF10VI GCNNNNNNNGC 1 cut(s) 668
HpyF3I CTNAG 1 cut(s) 700
Hsp92II CATG 8 cut(s) 52, 113, 175, 340, 448, 519, 579, 659
HspAI GCGC 1 cut(s) 490
KflI GGGWCCC 1 cut(s) 116
Ksp22I TGATCA 1 cut(s) 153
Kzo9I GATC 5 cut(s) 153, 707, 711, 733, 737
Lsp1109I GCAGC 2 cut(s) 520, 671
LweI GCATC 2 cut(s) 84, 604
MabI ACCWGGT 1 cut(s) 241
MaeIII GTNAC 2 cut(s) 430, 723
MalI GATC 5 cut(s) 155, 709, 713, 735, 739
MboI GATC 5 cut(s) 153, 707, 711, 733, 737
MboII GAAGA 2 cut(s) 477, 698
MluCI AATT 3 cut(s) 226, 455, 754
MlyI GAGTC 1 cut(s) 22
MnlI CCTC 7 cut(s) 106, 179, 292, 553, 576, 586, 596
MseI TTAA 4 cut(s) 78, 161, 383, 753
MslI CAYNNNNRTG 4 cut(s) 136, 574, 719, 745
MspI CCGG 1 cut(s) 398
MspR9I CCNGG 3 cut(s) 19, 70, 243
MvaI CCWGG 3 cut(s) 19, 70, 243
MwoI GCNNNNNNNGC 1 cut(s) 668
NdeI CATATG 1 cut(s) 561
NdeII GATC 5 cut(s) 153, 707, 711, 733, 737
NlaIII CATG 8 cut(s) 52, 113, 175, 340, 448, 519, 579, 659
NlaIV GGNNCC 3 cut(s) 117, 118, 240
NmeAIII GCCGAG 1 cut(s) 386
NmuCI GTSAC 2 cut(s) 430, 723
PfeI GAWTC 2 cut(s) 65, 257
PfoI TCCNGGA 1 cut(s) 68
PkrI GCNGC 2 cut(s) 535, 661
PleI GAGTC 1 cut(s) 21
PpsI GAGTC 1 cut(s) 21
PpuMI RGGWCCY 1 cut(s) 116
PsiI TTATAA 1 cut(s) 225
Psp5II RGGWCCY 1 cut(s) 116
Psp6I CCWGG 3 cut(s) 17, 68, 241
PspGI CCWGG 3 cut(s) 17, 68, 241
PspN4I GGNNCC 3 cut(s) 117, 118, 240
PspPI GGNCC 1 cut(s) 116
PspPPI RGGWCCY 1 cut(s) 116
PstNI CAGNNNCTG 1 cut(s) 307
RsaI GTAC 1 cut(s) 108
RsaNI GTAC 1 cut(s) 107
RseI CAYNNNNRTG 4 cut(s) 136, 574, 719, 745
SaqAI TTAA 4 cut(s) 78, 161, 383, 753
SatI GCNGC 2 cut(s) 534, 660
Sau3AI GATC 5 cut(s) 153, 707, 711, 733, 737
Sau96I GGNCC 1 cut(s) 116
SchI GAGTC 1 cut(s) 22
ScrFI CCNGG 3 cut(s) 19, 70, 243
SetI ASST 5 cut(s) 247, 284, 545, 607, 664
SexAI ACCWGGT 1 cut(s) 241
SfaNI GCATC 2 cut(s) 84, 604
SfcI CTRYAG 2 cut(s) 285, 372
SinI GGWCC 1 cut(s) 116
SmiMI CAYNNNNRTG 4 cut(s) 136, 574, 719, 745
Sse9I AATT 3 cut(s) 226, 455, 754
SsiI CCGC 2 cut(s) 125, 179
SspI AATATT 1 cut(s) 381
StyD4I CCNGG 3 cut(s) 17, 68, 241
TaaI ACNGT 3 cut(s) 166, 436, 476
TaqI TCGA 3 cut(s) 44, 710, 736
TasI AATT 3 cut(s) 226, 455, 754
TatI WGTACW 1 cut(s) 106
TfiI GAWTC 2 cut(s) 65, 257
Tru1I TTAA 4 cut(s) 78, 161, 383, 753
Tru9I TTAA 4 cut(s) 78, 161, 383, 753
TscAI CASTG 4 cut(s) 65, 556, 673, 680
TseFI GTSAC 2 cut(s) 430, 723
TseI GCWGC 2 cut(s) 533, 659
Tsp45I GTSAC 2 cut(s) 430, 723
TspDTI ATGAA 3 cut(s) 45, 325, 644
TspRI CASTG 4 cut(s) 65, 556, 673, 680
VpaK11BI GGWCC 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.