Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006027.1

Orthogroup ID

OG0008024

Physical Location & Seq

Genomic Coordinates Reverse (-)

28380 .. 30908

Gene Structure 2529 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006027.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1119 bp

atgtcgtctgatttcaagttagagggagttaaagaccatgaaattgaggacccagaaattggttctccaaatggaatacataatattcttgcggagcgaagaactatgactctcagtgacaggttgtttagagggaatcgagcagggcatggtgacaccatctcttttagtccgagtgacggaaatgaaaatcatggacatgggtcagcaaagaaatctggacctctgttgtctgggacagcatattgcatttcatcctgcagcatgatattgctgaacaaagttgttctatccagttacaacttcaatgcaggagtatcattgatgttttatcaaaatttgataagtactgtaattgttgtattcttggccttctctggagttgttactgtggaaaagctcaattggaaactgattaaggtctggatccctgttaatgtaatcttcatcggcatgcttgtatcaggcatgtatagtttgaaatacgtaaatattgcaatggtgaccattctgaagaatgtgacaaatattttaacagcactgggagaattatacatgttccggaaacaccagaatcagaaagtgtggactgccatgtttctgatgattatctctgctatcagcagtggcattacagatatctcctttgatactgtaggttatgcttggcaattttcaaattgcatactaacagcaagctactcactcactctacggcgagtaatggatgaagcaaaaaagtacacaagatccggatctctaaatgaagtttcaatggtcttgctgaataatttgctatctctaccttttgctgccttcttgattattctgtttgatgaatgggaatatgtgatcaatgcggatgtagttaagttgccagtgttttgggttgttgcaacagctagtggattgcttggactttccattagcttcacttccatgtggtttctacatcaaactggcccaaccacctatagtctggtgggttccttaaacaagattcctgtctctattgctggtttagtcctgttcagggtgcctctcagtctaccaaacctcttcagcatactatttggtttatttgctggaatatttttcgccagggcaaaaatgacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TPT

Protein Analysis

372

Amino Acids

41.11

Weight (kDa)

8.99

Isoelectric Point (pI)

30.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008024)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G13650 AT2G13650
fragaria_vesca	FvH4_3g38300 FvH4_3g38300
malus_domestica	MD03G1073200.v1.1 MD11G1079100.v1.1
prunus_persica	Prupe.6G059800_v2.0.a1 Prupe.6G059800_v2.0.a1 Prupe.6G059800_v2.0.a1 Prupe.6G059800_v2.0.a1 Prupe.6G059800_v2.0.a1
pyrus_communis	pycom03g05920
rosa_chinensis	RchiOBHm_Chr5g0068881
rosa_laevigata	RLG00000036016
rosa_multiflora	Rmu_sc0006027.1_g000010
rosa_roxburghii	Rroxscaffold_1G00011920
rosa_rugosa	Rorug05G0394100.1 Rorug05G0394200 Rorug05G0394200
rosa_samantha	Rh5AG451200 Rh5BG469600 Rh5CG492300 Rh5DG482900
rosa_wichuraiana	Rw5G042110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	1036
AccB7I	CCANNNNNTGG	1 cut(s)	59
AccI	GTMKAC	1 cut(s)	1048
AccIII	TCCGGA	2 cut(s)	561, 752
AciI	CCGC	2 cut(s)	92, 860
AclWI	GGATC	4 cut(s)	421, 434, 744, 763
AcsI	RAATTY	1 cut(s)	337
AcuI	CTGAAG	2 cut(s)	533, 1045
AfaI	GTAC	2 cut(s)	349, 743
AfiI	CCNNNNNNNGG	3 cut(s)	59, 179, 1033
AflIII	ACRYGT	1 cut(s)	555
AgsI	TTSAA	5 cut(s)	16, 307, 481, 678, 774
AjnI	CCWGG	1 cut(s)	1100
AluBI	AGCT	4 cut(s)	400, 699, 902, 930
AluI	AGCT	4 cut(s)	400, 699, 902, 930
Alw26I	GTCTC	1 cut(s)	1012
AlwI	GGATC	4 cut(s)	421, 434, 744, 763
Aor13HI	TCCGGA	2 cut(s)	561, 752
AoxI	GGCC	2 cut(s)	369, 961
ApeKI	GCWGC	2 cut(s)	261, 812
ApoI	RAATTY	1 cut(s)	337
AspS9I	GGNCC	3 cut(s)	49, 221, 962
AsuHPI	GGTGA	2 cut(s)	164, 514
AvaII	GGWCC	2 cut(s)	49, 221
BamHI	GGATCC	1 cut(s)	426
BanI	GGYRCC	1 cut(s)	1036
BbvI	GCAGC	2 cut(s)	273, 799
BccI	CCATC	1 cut(s)	167
BceAI	ACGGC	1 cut(s)	731
BciT130I	CCWGG	1 cut(s)	1102
BclI	TGATCA	1 cut(s)	852
BcoDI	GTCTC	1 cut(s)	1012
BfaI	CTAG	1 cut(s)	903
BfmI	CTRYAG	3 cut(s)	259, 654, 973
BisI	GCNGC	2 cut(s)	262, 813
BlsI	GCNGC	2 cut(s)	263, 814
BmcAI	AGTACT	1 cut(s)	349
Bme1390I	CCNGG	1 cut(s)	1102
Bme18I	GGWCC	2 cut(s)	49, 221
BmgT120I	GGNCC	3 cut(s)	49, 221, 962
BmiI	GGNNCC	4 cut(s)	51, 428, 988, 1038
BmrFI	CCNGG	1 cut(s)	1102
BmrI	ACTGGG	1 cut(s)	551
BmuI	ACTGGG	1 cut(s)	551
BoxI	GACNNNNGTC	1 cut(s)	202
BpmI	CTGGAG	1 cut(s)	399
BsaAI	YACGTR	1 cut(s)	487
BsaBI	GATNNNNATC	2 cut(s)	608, 754
BsaJI	CCNNGG	1 cut(s)	1101
BsaWI	WCCGGW	2 cut(s)	561, 752
Bsc4I	CCNNNNNNNGG	3 cut(s)	59, 179, 1033
Bse1I	ACTGG	4 cut(s)	294, 546, 878, 964
Bse3DI	GCAATG	1 cut(s)	504
Bse8I	GATNNNNATC	2 cut(s)	608, 754
BseAI	TCCGGA	2 cut(s)	561, 752
BseBI	CCWGG	1 cut(s)	1102
BseDI	CCNNGG	1 cut(s)	1101
BseGI	GGATG	3 cut(s)	254, 733, 868
BseJI	GATNNNNATC	2 cut(s)	608, 754
BseLI	CCNNNNNNNGG	3 cut(s)	59, 179, 1033
BseMI	GCAATG	1 cut(s)	504
BseMII	CTCAG	2 cut(s)	127, 1057
BseNI	ACTGG	4 cut(s)	294, 546, 878, 964
BseXI	GCAGC	2 cut(s)	273, 799
BshFI	GGCC	2 cut(s)	371, 963
BshNI	GGYRCC	1 cut(s)	1036
BsiSI	CCGG	2 cut(s)	562, 753
BslFI	GGGAC	1 cut(s)	250
BslI	CCNNNNNNNGG	3 cut(s)	59, 179, 1033
BsmAI	GTCTC	1 cut(s)	1012
BsmFI	GGGAC	1 cut(s)	250
BsnI	GGCC	2 cut(s)	371, 963
Bsp13I	TCCGGA	2 cut(s)	561, 752
Bsp143I	GATC	4 cut(s)	426, 749, 755, 852
BspACI	CCGC	2 cut(s)	92, 860
BspANI	GGCC	2 cut(s)	371, 963
BspCNI	CTCAG	2 cut(s)	126, 1056
BspEI	TCCGGA	2 cut(s)	561, 752
BspLI	GGNNCC	4 cut(s)	51, 428, 988, 1038
BspMAI	CTGCAG	1 cut(s)	263
BspPI	GGATC	4 cut(s)	421, 434, 744, 763
BspT107I	GGYRCC	1 cut(s)	1036
BsrDI	GCAATG	1 cut(s)	504
BsrI	ACTGG	4 cut(s)	294, 546, 878, 964
BssECI	CCNNGG	1 cut(s)	1101
BssMI	GATC	4 cut(s)	426, 749, 755, 852
Bst2UI	CCWGG	1 cut(s)	1102
Bst4CI	ACNGT	3 cut(s)	352, 391, 655
Bst6I	CTCTTC	1 cut(s)	1064
BstBAI	YACGTR	1 cut(s)	487
BstC8I	GCNNGC	2 cut(s)	455, 697
BstDEI	CTNAG	2 cut(s)	113, 1043
BstEII	GGTNACC	1 cut(s)	502
BstF5I	GGATG	3 cut(s)	254, 733, 868
BstKTI	GATC	4 cut(s)	429, 752, 758, 855
BstMAI	GTCTC	1 cut(s)	1012
BstMBI	GATC	4 cut(s)	426, 749, 755, 852
BstNI	CCWGG	1 cut(s)	1102
BstNSI	RCATGY	3 cut(s)	457, 472, 559
BstPAI	GACNNNNGTC	1 cut(s)	202
BstPI	GGTNACC	1 cut(s)	502
BstSCI	CCNGG	1 cut(s)	1100
BstSFI	CTRYAG	3 cut(s)	259, 654, 973
BstSNI	TACGTA	1 cut(s)	487
BstV1I	GCAGC	2 cut(s)	273, 799
BstX2I	RGATCY	3 cut(s)	426, 749, 755
BstXI	CCANNNNNNTGG	1 cut(s)	885
BstYI	RGATCY	3 cut(s)	426, 749, 755
BsuRI	GGCC	2 cut(s)	371, 963
BtsCI	GGATG	3 cut(s)	254, 733, 868
BtsI	GCAGTG	1 cut(s)	631
BtsIMutI	CAGTG	4 cut(s)	121, 539, 631, 885
Cac8I	GCNNGC	2 cut(s)	455, 697
Cfr13I	GGNCC	3 cut(s)	49, 221, 962
Csp6I	GTAC	2 cut(s)	348, 742
CviJI	RGCY	6 cut(s)	371, 400, 699, 902, 930, 963
CviKI_1	RGCY	6 cut(s)	371, 400, 699, 902, 930, 963
CviQI	GTAC	2 cut(s)	348, 742
DdeI	CTNAG	2 cut(s)	113, 1043
DpnI	GATC	4 cut(s)	428, 751, 757, 854
DpnII	GATC	4 cut(s)	426, 749, 755, 852
Eam1104I	CTCTTC	1 cut(s)	1064
EarI	CTCTTC	1 cut(s)	1064
Eco105I	TACGTA	1 cut(s)	487
Eco32I	GATATC	1 cut(s)	640
Eco47I	GGWCC	2 cut(s)	49, 221
Eco57I	CTGAAG	2 cut(s)	533, 1045
Eco91I	GGTNACC	1 cut(s)	502
EcoO109I	RGGNCCY	1 cut(s)	49
EcoO65I	GGTNACC	1 cut(s)	502
EcoRII	CCWGG	1 cut(s)	1100
EcoRV	GATATC	1 cut(s)	640
FaqI	GGGAC	1 cut(s)	250
FbaI	TGATCA	1 cut(s)	852
FblI	GTMKAC	1 cut(s)	1048
Fnu4HI	GCNGC	2 cut(s)	262, 813
FokI	GGATG	3 cut(s)	241, 740, 875
Fsp4HI	GCNGC	2 cut(s)	262, 813
FspBI	CTAG	1 cut(s)	903
GluI	GCNGC	2 cut(s)	262, 813
GsuI	CTGGAG	1 cut(s)	399
HaeIII	GGCC	2 cut(s)	371, 963
HapII	CCGG	2 cut(s)	562, 753
HinfI	GANTC	4 cut(s)	109, 136, 574, 1000
HpaII	CCGG	2 cut(s)	562, 753
HphI	GGTGA	2 cut(s)	164, 514
Hpy166II	GTNNAC	3 cut(s)	588, 744, 1049
Hpy188I	TCNGA	5 cut(s)	10, 174, 513, 579, 603
Hpy188III	TCNNGA	6 cut(s)	219, 378, 424, 562, 753, 820
Hpy8I	GTNNAC	3 cut(s)	588, 744, 1049
HpyAV	CCTTC	2 cut(s)	382, 826
HpyCH4III	ACNGT	3 cut(s)	352, 391, 655
HpyCH4IV	ACGT	1 cut(s)	486
HpyCH4V	TGCA	6 cut(s)	249, 261, 311, 497, 684, 896
HpyF3I	CTNAG	2 cut(s)	113, 1043
HpySE526I	ACGT	1 cut(s)	486
Kpn2I	TCCGGA	2 cut(s)	561, 752
Ksp22I	TGATCA	1 cut(s)	852
Kzo9I	GATC	4 cut(s)	426, 749, 755, 852
LmnI	GCTCC	1 cut(s)	94
Lsp1109I	GCAGC	2 cut(s)	273, 799
MaeI	CTAG	1 cut(s)	903
MaeII	ACGT	1 cut(s)	486
MaeIII	GTNAC	7 cut(s)	116, 152, 176, 296, 385, 502, 520
MalI	GATC	4 cut(s)	428, 751, 757, 854
MboI	GATC	4 cut(s)	426, 749, 755, 852
MboII	GAAGA	4 cut(s)	111, 436, 526, 1051
MfeI	CAATTG	1 cut(s)	403
MflI	RGATCY	3 cut(s)	426, 749, 755
MluCI	AATT	9 cut(s)	42, 57, 337, 354, 403, 548, 671, 679, 790
MlyI	GAGTC	1 cut(s)	103
MnlI	CCTC	6 cut(s)	16, 40, 125, 234, 1050, 1067
MroI	TCCGGA	2 cut(s)	561, 752
MseI	TTAA	6 cut(s)	30, 417, 435, 533, 870, 992
MslI	CAYNNNNRTG	3 cut(s)	198, 452, 938
MspI	CCGG	2 cut(s)	562, 753
MspR9I	CCNGG	1 cut(s)	1102
MunI	CAATTG	1 cut(s)	403
MvaI	CCWGG	1 cut(s)	1102
NdeII	GATC	4 cut(s)	426, 749, 755, 852
NlaIV	GGNNCC	4 cut(s)	51, 428, 988, 1038
NmuCI	GTSAC	5 cut(s)	116, 152, 176, 502, 520
NspI	RCATGY	3 cut(s)	457, 472, 559
PaeI	GCATGC	1 cut(s)	457
PciI	ACATGT	1 cut(s)	555
PfeI	GAWTC	3 cut(s)	136, 574, 1000
PflMI	CCANNNNNTGG	1 cut(s)	59
PkrI	GCNGC	2 cut(s)	263, 814
PleI	GAGTC	1 cut(s)	103
PpsI	GAGTC	1 cut(s)	103
Ppu21I	YACGTR	1 cut(s)	487
PpuMI	RGGWCCY	1 cut(s)	49
PscI	ACATGT	1 cut(s)	555
PshAI	GACNNNNGTC	1 cut(s)	202
Psp5II	RGGWCCY	1 cut(s)	49
Psp6I	CCWGG	1 cut(s)	1100
PspEI	GGTNACC	1 cut(s)	502
PspGI	CCWGG	1 cut(s)	1100
PspN4I	GGNNCC	4 cut(s)	51, 428, 988, 1038
PspPI	GGNCC	3 cut(s)	49, 221, 962
PspPPI	RGGWCCY	1 cut(s)	49
PstI	CTGCAG	1 cut(s)	263
PsuI	RGATCY	3 cut(s)	426, 749, 755
RsaI	GTAC	2 cut(s)	349, 743
RsaNI	GTAC	2 cut(s)	348, 742
RseI	CAYNNNNRTG	3 cut(s)	198, 452, 938
SaqAI	TTAA	6 cut(s)	30, 417, 435, 533, 870, 992
SatI	GCNGC	2 cut(s)	262, 813
Sau3AI	GATC	4 cut(s)	426, 749, 755, 852
Sau96I	GGNCC	3 cut(s)	49, 221, 962
ScaI	AGTACT	1 cut(s)	349
SchI	GAGTC	1 cut(s)	103
ScrFI	CCNGG	1 cut(s)	1102
SfcI	CTRYAG	3 cut(s)	259, 654, 973
SinI	GGWCC	2 cut(s)	49, 221
SmiMI	CAYNNNNRTG	3 cut(s)	198, 452, 938
SnaBI	TACGTA	1 cut(s)	487
SphI	GCATGC	1 cut(s)	457
Sse9I	AATT	9 cut(s)	42, 57, 337, 354, 403, 548, 671, 679, 790
SsiI	CCGC	2 cut(s)	92, 860
SspI	AATATT	4 cut(s)	85, 493, 529, 1092
SspMI	CTAG	1 cut(s)	903
StyD4I	CCNGG	1 cut(s)	1100
TaaI	ACNGT	3 cut(s)	352, 391, 655
TaiI	ACGT	1 cut(s)	489
TaqI	TCGA	1 cut(s)	139
TasI	AATT	9 cut(s)	42, 57, 337, 354, 403, 548, 671, 679, 790
TatI	WGTACW	2 cut(s)	347, 741
TfiI	GAWTC	3 cut(s)	136, 574, 1000
Tru1I	TTAA	6 cut(s)	30, 417, 435, 533, 870, 992
Tru9I	TTAA	6 cut(s)	30, 417, 435, 533, 870, 992
TscAI	CASTG	4 cut(s)	121, 546, 631, 885
TseFI	GTSAC	5 cut(s)	116, 152, 176, 502, 520
TseI	GCWGC	2 cut(s)	261, 812
Tsp45I	GTSAC	5 cut(s)	116, 152, 176, 502, 520
TspDTI	ATGAA	7 cut(s)	54, 201, 243, 436, 744, 780, 852
TspGWI	ACGGA	1 cut(s)	195
TspRI	CASTG	4 cut(s)	121, 546, 631, 885
Van91I	CCANNNNNTGG	1 cut(s)	59
VpaK11BI	GGWCC	2 cut(s)	49, 221
XapI	RAATTY	1 cut(s)	337
XceI	RCATGY	3 cut(s)	457, 472, 559
XcmI	CCANNNNNNNNNTGG	1 cut(s)	976
XmiI	GTMKAC	1 cut(s)	1048
XspI	CTAG	1 cut(s)	903
ZrmI	AGTACT	1 cut(s)	349

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.