Rmu_sc0006071.1_g000001

60S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006071.1
Physical Location & Seq
Forward (+)
1 .. 926
926 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006071.1_g000001.1.cds

Sequence Viewer

Length: 181 bp
gtttatcattggtttcttccttgctgctattccatggtatgttggggcgattatttttgtttgttccaggaataggatggactaccgagagaaaccaggatatatcgcttgctcagttgccgctattcttgctacaattgctattgtccttggtgccacaaagggaagtgatgactggtag

Protein Analysis

59

Amino Acids

6.46

Weight (kDa)

8.01

Isoelectric Point (pI)

12.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 153
AciI CCGC 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 73
AjnI CCWGG 2 cut(s) 66, 95
ApeKI GCWGC 1 cut(s) 24
BanI GGYRCC 1 cut(s) 153
BbvI GCAGC 1 cut(s) 11
BccI CCATC 1 cut(s) 71
BciT130I CCWGG 2 cut(s) 68, 97
BisI GCNGC 2 cut(s) 25, 121
BlsI GCNGC 2 cut(s) 26, 122
Bme1390I CCNGG 2 cut(s) 68, 97
BmiI GGNNCC 1 cut(s) 155
BmrFI CCNGG 2 cut(s) 68, 97
BsaJI CCNNGG 2 cut(s) 33, 149
Bsc4I CCNNNNNNNGG 1 cut(s) 73
Bse1I ACTGG 1 cut(s) 180
BseBI CCWGG 2 cut(s) 68, 97
BseDI CCNNGG 2 cut(s) 33, 149
BseGI GGATG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 73
BseMII CTCAG 1 cut(s) 127
BseNI ACTGG 1 cut(s) 180
BseXI GCAGC 1 cut(s) 11
BshNI GGYRCC 1 cut(s) 153
BslI CCNNNNNNNGG 1 cut(s) 73
Bsp19I CCATGG 1 cut(s) 33
BspACI CCGC 1 cut(s) 121
BspCNI CTCAG 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 155
BspT107I GGYRCC 1 cut(s) 153
BsrI ACTGG 1 cut(s) 180
BssECI CCNNGG 2 cut(s) 33, 149
BssT1I CCWWGG 2 cut(s) 33, 149
Bst2UI CCWGG 2 cut(s) 68, 97
BstC8I GCNNGC 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 113
BstDSI CCRYGG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 82
BstMWI GCNNNNNNNGC 2 cut(s) 129, 138
BstNI CCWGG 2 cut(s) 68, 97
BstSCI CCNGG 2 cut(s) 66, 95
BstV1I GCAGC 1 cut(s) 11
BtgI CCRYGG 1 cut(s) 33
BtsCI GGATG 1 cut(s) 82
Cac8I GCNNGC 1 cut(s) 110
CviAII CATG 1 cut(s) 34
DdeI CTNAG 1 cut(s) 113
Eco130I CCWWGG 2 cut(s) 33, 149
EcoRII CCWGG 2 cut(s) 66, 95
EcoT14I CCWWGG 2 cut(s) 33, 149
ErhI CCWWGG 2 cut(s) 33, 149
FaeI CATG 1 cut(s) 37
FaiI YATR 3 cut(s) 35, 40, 103
FatI CATG 1 cut(s) 33
Fnu4HI GCNGC 2 cut(s) 25, 121
FokI GGATG 1 cut(s) 89
Fsp4HI GCNGC 2 cut(s) 25, 121
GluI GCNGC 2 cut(s) 25, 121
Hin1II CATG 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 2 cut(s) 129, 138
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 1 cut(s) 37
LpnPI CCDG 5 cut(s) 53, 80, 82, 109, 161
Lsp1109I GCAGC 1 cut(s) 11
MboII GAAGA 1 cut(s) 8
MfeI CAATTG 1 cut(s) 136
MluCI AATT 1 cut(s) 136
MspR9I CCNGG 2 cut(s) 68, 97
MunI CAATTG 1 cut(s) 136
MvaI CCWGG 2 cut(s) 68, 97
MwoI GCNNNNNNNGC 2 cut(s) 129, 138
NcoI CCATGG 1 cut(s) 33
NlaIII CATG 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 155
PfoI TCCNGGA 1 cut(s) 66
PkrI GCNGC 2 cut(s) 26, 122
Psp6I CCWGG 2 cut(s) 66, 95
PspGI CCWGG 2 cut(s) 66, 95
PspN4I GGNNCC 1 cut(s) 155
SatI GCNGC 2 cut(s) 25, 121
ScrFI CCNGG 2 cut(s) 68, 97
Sse9I AATT 1 cut(s) 136
SsiI CCGC 1 cut(s) 121
StyD4I CCNGG 2 cut(s) 66, 95
StyI CCWWGG 2 cut(s) 33, 149
TasI AATT 1 cut(s) 136
TauI GCSGC 1 cut(s) 123
TseI GCWGC 1 cut(s) 24
XcmI CCANNNNNNNNNTGG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.