Rmu_sc0006323.1_g000019

Mitochondrial outer membrane protein porin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006323.1
OG0014819
Physical Location & Seq
Forward (+)
97144 .. 98907
1764 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006323.1_g000019.1.cds

Sequence Viewer

Length: 870 bp
atgggcaagtctaatcataaaaaacacaagcacaagcacaatcacaagcaacctctatttttctccgagtttgctcagaaatctacagagttgcttacaaagggttactacagaggccagatatttagcttcacaacccacaaagatgaactggaccttacttcaaccattgcaagtaatggaagacacacaactgcaggtgtggtaggagcatacccatataaaaatgcaacctttagagttggagttgacaaggattcaaaaattgcagcaaacttcactgtaagtgagaagtttctttcaggcacaaagactacagcttcattgagcttccctgattataaatctagcaagctcaaatttcaatgtctccgagaatatgctgctctagccatgtctgtttctctgaaccagtatcctgcaatcaaattttcagctgctgttggttcttcaattgttgcccttggcatggaggcagagttcatgactacttctagatgtttctccaagtgcagcgcaggcattaacatgaagggtctcaattgcaatgcttcaataattctggaaaacaaaggtgacttgttaaatgcatcatatgttcattatcttgatccagagaagaggaatgcagcagtggtacagttcactcaagaactctcaacaaagagaaacaccttaaccgttggaggatcatgtgctgttgatagtcatacagcagtgaaggctagactcgaagatcgagggaggttaagaactaccctagagtacaatttcagacccaagtcatgcttgtctatctctggagagttcaacaccaaggcagttgacaggagtcctaaaattggtctggaacttgctattgatctctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04020 ko04022 ko04216 ko04217 ko04218 ko04621 ko04979 ko05012 ko05016 ko05166 map04020 map04022 map04216 map04217 map04218 map04621 map04979 map05012 map05016 map05166
Pfam Domains
Protein Families
Porin_3

Protein Analysis

289

Amino Acids

31.85

Weight (kDa)

9.53

Isoelectric Point (pI)

31.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014819)

Species Orthologous Gene IDs
malus_domestica MD05G1100000.v1.1 MD05G1100300.v1.1
prunus_persica Prupe.8G144700_v2.0.a1
pyrus_communis pycom05g09890
rosa_chinensis RchiOBHm_Chr6g0253791
rosa_laevigata RLG00000014970
rosa_multiflora Rmu_sc0006323.1_g000019
rosa_roxburghii Rroxscaffold_7G00211520
rosa_rugosa Rorug05G0547200 Rorug05G0547200
rosa_samantha Rh6AG062800 Rh6BG056100 Rh6CG055600 Rh6CG056200 Rh6DG053200 Rh6DG054000
rosa_wichuraiana Rw6G005590

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 342
AarI CACCTGC 1 cut(s) 188
Acc36I ACCTGC 1 cut(s) 188
AclWI GGATC 2 cut(s) 605, 697
AcsI RAATTY 2 cut(s) 359, 428
AfaI GTAC 2 cut(s) 639, 767
AfiI CCNNNNNNNGG 2 cut(s) 469, 842
AgsI TTSAA 6 cut(s) 165, 261, 365, 453, 555, 811
AloI GAACNNNNNNTCC 2 cut(s) 464, 496
AluBI AGCT 5 cut(s) 129, 320, 330, 355, 437
AluI AGCT 5 cut(s) 129, 320, 330, 355, 437
Alw26I GTCTC 2 cut(s) 374, 542
AlwI GGATC 2 cut(s) 605, 697
AlwNI CAGNNNCTG 1 cut(s) 440
AoxI GGCC 1 cut(s) 115
ApeKI GCWGC 5 cut(s) 269, 383, 437, 513, 629
ApoI RAATTY 2 cut(s) 359, 428
AspLEI GCGC 1 cut(s) 518
AspS9I GGNCC 1 cut(s) 154
AsuHPI GGTGA 1 cut(s) 587
AvaII GGWCC 1 cut(s) 154
BbsI GAAGAC 1 cut(s) 190
BbvI GCAGC 5 cut(s) 281, 370, 424, 525, 641
BciVI GTATCC 1 cut(s) 426
BcoDI GTCTC 2 cut(s) 374, 542
BfaI CTAG 5 cut(s) 348, 389, 495, 726, 761
BfmI CTRYAG 4 cut(s) 84, 109, 195, 315
BfuAI ACCTGC 1 cut(s) 188
BfuI GTATCC 1 cut(s) 426
BisI GCNGC 5 cut(s) 270, 384, 438, 514, 630
BlsI GCNGC 5 cut(s) 271, 385, 439, 515, 631
Bme18I GGWCC 1 cut(s) 154
BmgT120I GGNCC 1 cut(s) 154
BmsI GCATC 1 cut(s) 599
BoxI GACNNNNGTC 2 cut(s) 781, 831
BpiI GAAGAC 1 cut(s) 190
BpmI CTGGAG 1 cut(s) 822
BpuEI CTTGAG 1 cut(s) 633
BsaI GGTCTC 1 cut(s) 542
BsaJI CCNNGG 2 cut(s) 463, 816
BsaXI ACNNNNNCTCC 2 cut(s) 464, 494
Bsc4I CCNNNNNNNGG 2 cut(s) 469, 842
Bse1I ACTGG 2 cut(s) 156, 412
Bse3DI GCAATG 2 cut(s) 168, 553
BseDI CCNNGG 2 cut(s) 463, 816
BseLI CCNNNNNNNGG 2 cut(s) 469, 842
BseMI GCAATG 2 cut(s) 168, 553
BseMII CTCAG 1 cut(s) 89
BseNI ACTGG 2 cut(s) 156, 412
BseXI GCAGC 5 cut(s) 281, 370, 424, 525, 641
BsgI GTGCAG 1 cut(s) 532
BshFI GGCC 1 cut(s) 117
BslI CCNNNNNNNGG 2 cut(s) 469, 842
BsmAI GTCTC 2 cut(s) 374, 542
BsmI GAATGC 1 cut(s) 631
BsnI GGCC 1 cut(s) 117
Bso31I GGTCTC 1 cut(s) 542
Bsp143I GATC 4 cut(s) 610, 689, 736, 862
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 88
BspHI TCATGA 1 cut(s) 483
BspMAI CTGCAG 1 cut(s) 199
BspMI ACCTGC 1 cut(s) 188
BspPI GGATC 2 cut(s) 605, 697
BspTNI GGTCTC 1 cut(s) 542
BsrDI GCAATG 2 cut(s) 168, 553
BsrI ACTGG 2 cut(s) 156, 412
BssECI CCNNGG 2 cut(s) 463, 816
BssMI GATC 4 cut(s) 610, 689, 736, 862
BssT1I CCWWGG 2 cut(s) 463, 816
Bst4CI ACNGT 3 cut(s) 283, 642, 682
Bst6I CTCTTC 1 cut(s) 614
BstC8I GCNNGC 2 cut(s) 353, 520
BstDEI CTNAG 1 cut(s) 75
BstHHI GCGC 1 cut(s) 518
BstKTI GATC 4 cut(s) 613, 692, 739, 865
BstMAI GTCTC 2 cut(s) 374, 542
BstMBI GATC 4 cut(s) 610, 689, 736, 862
BstMWI GCNNNNNNNGC 3 cut(s) 389, 519, 722
BstPAI GACNNNNGTC 2 cut(s) 781, 831
BstSFI CTRYAG 4 cut(s) 84, 109, 195, 315
BstV1I GCAGC 5 cut(s) 281, 370, 424, 525, 641
BstV2I GAAGAC 1 cut(s) 190
BsuI GTATCC 1 cut(s) 426
BsuRI GGCC 1 cut(s) 117
BtsI GCAGTG 2 cut(s) 639, 723
BtsIMutI CAGTG 3 cut(s) 279, 639, 723
BveI ACCTGC 1 cut(s) 188
Cac8I GCNNGC 2 cut(s) 353, 520
CaiI CAGNNNCTG 1 cut(s) 440
CciI TCATGA 1 cut(s) 483
CfoI GCGC 1 cut(s) 518
Cfr13I GGNCC 1 cut(s) 154
Csp6I GTAC 2 cut(s) 638, 766
CviAII CATG 6 cut(s) 394, 469, 484, 529, 693, 786
CviJI RGCY 8 cut(s) 117, 129, 320, 330, 355, 392, 437, 725
CviKI_1 RGCY 8 cut(s) 117, 129, 320, 330, 355, 392, 437, 725
CviQI GTAC 2 cut(s) 638, 766
DdeI CTNAG 1 cut(s) 75
DpnI GATC 4 cut(s) 612, 691, 738, 864
DpnII GATC 4 cut(s) 610, 689, 736, 862
Eam1104I CTCTTC 1 cut(s) 614
EarI CTCTTC 1 cut(s) 614
Eco130I CCWWGG 2 cut(s) 463, 816
Eco31I GGTCTC 1 cut(s) 542
Eco47I GGWCC 1 cut(s) 154
EcoT14I CCWWGG 2 cut(s) 463, 816
EcoT22I ATGCAT 1 cut(s) 592
ErhI CCWWGG 2 cut(s) 463, 816
FaeI CATG 6 cut(s) 397, 472, 487, 532, 696, 789
FalI AAGNNNNNCTT 2 cut(s) 773, 805
FatI CATG 6 cut(s) 393, 468, 483, 528, 692, 785
FauNDI CATATG 1 cut(s) 595
Fnu4HI GCNGC 5 cut(s) 270, 384, 438, 514, 630
Fsp4HI GCNGC 5 cut(s) 270, 384, 438, 514, 630
FspBI CTAG 5 cut(s) 348, 389, 495, 726, 761
GlaI GCGC 1 cut(s) 517
GluI GCNGC 5 cut(s) 270, 384, 438, 514, 630
GsuI CTGGAG 1 cut(s) 822
HaeIII GGCC 1 cut(s) 117
HhaI GCGC 1 cut(s) 518
Hin1II CATG 6 cut(s) 397, 472, 487, 532, 696, 789
Hin6I GCGC 1 cut(s) 516
HinP1I GCGC 1 cut(s) 516
HincII GTYRAC 2 cut(s) 250, 826
HindII GTYRAC 2 cut(s) 250, 826
HinfI GANTC 3 cut(s) 257, 729, 832
HphI GGTGA 1 cut(s) 587
Hpy166II GTNNAC 3 cut(s) 250, 645, 826
Hpy188I TCNGA 6 cut(s) 67, 78, 374, 408, 776, 869
Hpy188III TCNNGA 8 cut(s) 484, 495, 563, 608, 614, 650, 801, 848
Hpy8I GTNNAC 3 cut(s) 250, 645, 826
HpyAV CCTTC 2 cut(s) 526, 715
HpyCH4III ACNGT 3 cut(s) 283, 642, 682
HpyCH4V TGCA 9 cut(s) 173, 197, 230, 269, 422, 513, 546, 590, 629
HpyF10VI GCNNNNNNNGC 3 cut(s) 389, 519, 722
HpyF3I CTNAG 1 cut(s) 75
Hsp92II CATG 6 cut(s) 397, 472, 487, 532, 696, 789
HspAI GCGC 1 cut(s) 516
Kzo9I GATC 4 cut(s) 610, 689, 736, 862
LmnI GCTCC 1 cut(s) 209
Lsp1109I GCAGC 5 cut(s) 281, 370, 424, 525, 641
LweI GCATC 1 cut(s) 599
MaeI CTAG 5 cut(s) 348, 389, 495, 726, 761
MaeIII GTNAC 2 cut(s) 104, 575
MalI GATC 4 cut(s) 612, 691, 738, 864
MboI GATC 4 cut(s) 610, 689, 736, 862
MboII GAAGA 4 cut(s) 195, 441, 631, 746
MfeI CAATTG 2 cut(s) 453, 541
MluCI AATT 8 cut(s) 264, 359, 428, 453, 541, 558, 769, 840
MlyI GAGTC 2 cut(s) 723, 841
MmeI TCCRAC 2 cut(s) 223, 664
MnlI CCTC 7 cut(s) 63, 107, 466, 615, 680, 734, 738
Mph1103I ATGCAT 1 cut(s) 592
MseI TTAA 4 cut(s) 525, 584, 677, 749
MslI CAYNNNNRTG 2 cut(s) 144, 527
MspA1I CMGCKG 1 cut(s) 437
MunI CAATTG 2 cut(s) 453, 541
Mva1269I GAATGC 1 cut(s) 631
MwoI GCNNNNNNNGC 3 cut(s) 389, 519, 722
NdeI CATATG 1 cut(s) 595
NdeII GATC 4 cut(s) 610, 689, 736, 862
NlaIII CATG 6 cut(s) 397, 472, 487, 532, 696, 789
NmuCI GTSAC 1 cut(s) 575
NsiI ATGCAT 1 cut(s) 592
PagI TCATGA 1 cut(s) 483
PaqCI CACCTGC 1 cut(s) 188
PctI GAATGC 1 cut(s) 631
PfeI GAWTC 1 cut(s) 257
PkrI GCNGC 5 cut(s) 271, 385, 439, 515, 631
PleI GAGTC 2 cut(s) 723, 840
PpsI GAGTC 2 cut(s) 723, 840
PshAI GACNNNNGTC 2 cut(s) 781, 831
PsiI TTATAA 1 cut(s) 342
PspPI GGNCC 1 cut(s) 154
PstI CTGCAG 1 cut(s) 199
PstNI CAGNNNCTG 1 cut(s) 440
PvuII CAGCTG 1 cut(s) 437
RsaI GTAC 2 cut(s) 639, 767
RsaNI GTAC 2 cut(s) 638, 766
RseI CAYNNNNRTG 2 cut(s) 144, 527
SaqAI TTAA 4 cut(s) 525, 584, 677, 749
SatI GCNGC 5 cut(s) 270, 384, 438, 514, 630
Sau3AI GATC 4 cut(s) 610, 689, 736, 862
Sau96I GGNCC 1 cut(s) 154
SchI GAGTC 2 cut(s) 723, 841
SfaNI GCATC 1 cut(s) 599
SfcI CTRYAG 4 cut(s) 84, 109, 195, 315
SinI GGWCC 1 cut(s) 154
SmiMI CAYNNNNRTG 2 cut(s) 144, 527
SmlI CTYRAG 1 cut(s) 648
SmoI CTYRAG 1 cut(s) 648
Sse9I AATT 8 cut(s) 264, 359, 428, 453, 541, 558, 769, 840
SspMI CTAG 5 cut(s) 348, 389, 495, 726, 761
StyI CCWWGG 2 cut(s) 463, 816
TaaI ACNGT 3 cut(s) 283, 642, 682
TaqI TCGA 2 cut(s) 732, 739
TasI AATT 8 cut(s) 264, 359, 428, 453, 541, 558, 769, 840
TatI WGTACW 1 cut(s) 765
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 4 cut(s) 525, 584, 677, 749
Tru9I TTAA 4 cut(s) 525, 584, 677, 749
TscAI CASTG 3 cut(s) 286, 639, 723
TseFI GTSAC 1 cut(s) 575
TseI GCWGC 5 cut(s) 269, 383, 437, 513, 629
Tsp45I GTSAC 1 cut(s) 575
TspDTI ATGAA 5 cut(s) 162, 312, 472, 545, 590
TspRI CASTG 3 cut(s) 286, 639, 723
VpaK11BI GGWCC 1 cut(s) 154
XapI RAATTY 2 cut(s) 359, 428
XbaI TCTAGA 1 cut(s) 494
XspI CTAG 5 cut(s) 348, 389, 495, 726, 761
Zsp2I ATGCAT 1 cut(s) 592
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.