Rmu_sc0007035.1_g000008

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007035.1
Physical Location & Seq
Forward (+)
39855 .. 40313
459 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007035.1_g000008.1.cds

Sequence Viewer

Length: 459 bp
atgtgttgcttagctagattgtatgattattatggtcttgttgaagtgctttgtaggaaaagaaattcgggtagagcgttggaggtggtggatgagctgtggaggacaagaaatgttccgagcttattgattgcttgtaacactttggttgagggtttgaggaggtcagcgaggatcgatgaacctttagaagtgatggaaaggatgcttgaagagggtatggttccagattttgtgatttttaattgcctccttcaagatctttgcaatttggggagaactgaggaagctgataaccttaggttgttgtctttgagtaaaggcttggagctagacggcatggcttattttggtggttgggtattcaagagaagggaaaaagaatcggtgaaagtggtggtggatgagatgcttgataggtataaacttgctacatataataggttggcggatggataa

Protein Analysis

152

Amino Acids

17.56

Weight (kDa)

5.19

Isoelectric Point (pI)

46.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 449
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 1 cut(s) 64
AgsI TTSAA 4 cut(s) 44, 212, 257, 367
AluBI AGCT 5 cut(s) 14, 97, 123, 290, 331
AluI AGCT 5 cut(s) 14, 97, 123, 290, 331
AlwI GGATC 1 cut(s) 182
ApoI RAATTY 1 cut(s) 64
AsuHPI GGTGA 1 cut(s) 400
AxyI CCTNAGG 1 cut(s) 299
BccI CCATC 2 cut(s) 190, 446
BceAI ACGGC 1 cut(s) 352
BfaI CTAG 2 cut(s) 15, 332
BglII AGATCT 1 cut(s) 259
BlpI GCTNAGC 1 cut(s) 10
BmiI GGNNCC 1 cut(s) 225
BmsI GCATC 2 cut(s) 195, 399
Bpu1102I GCTNAGC 1 cut(s) 10
Bsa29I ATCGAT 1 cut(s) 177
Bse21I CCTNAGG 1 cut(s) 299
BseCI ATCGAT 1 cut(s) 177
BseGI GGATG 4 cut(s) 97, 210, 409, 457
BseMII CTCAG 1 cut(s) 273
BseRI GAGGAG 1 cut(s) 175
BshVI ATCGAT 1 cut(s) 177
Bsp143I GATC 2 cut(s) 174, 259
Bsp1720I GCTNAGC 1 cut(s) 10
BspACI CCGC 1 cut(s) 449
BspCNI CTCAG 1 cut(s) 274
BspDI ATCGAT 1 cut(s) 177
BspLI GGNNCC 1 cut(s) 225
BspPI GGATC 1 cut(s) 182
BssMI GATC 2 cut(s) 174, 259
Bst6I CTCTTC 1 cut(s) 207
BstDEI CTNAG 3 cut(s) 10, 282, 299
BstF5I GGATG 4 cut(s) 97, 210, 409, 457
BstKTI GATC 2 cut(s) 177, 262
BstMBI GATC 2 cut(s) 174, 259
BstX2I RGATCY 1 cut(s) 259
BstYI RGATCY 1 cut(s) 259
Bsu15I ATCGAT 1 cut(s) 177
Bsu36I CCTNAGG 1 cut(s) 299
BsuTUI ATCGAT 1 cut(s) 177
BtsCI GGATG 4 cut(s) 97, 210, 409, 457
ClaI ATCGAT 1 cut(s) 177
CviAII CATG 1 cut(s) 340
CviJI RGCY 7 cut(s) 14, 97, 123, 290, 324, 331, 344
CviKI_1 RGCY 7 cut(s) 14, 97, 123, 290, 324, 331, 344
DdeI CTNAG 3 cut(s) 10, 282, 299
DpnI GATC 2 cut(s) 176, 261
DpnII GATC 2 cut(s) 174, 259
Eam1104I CTCTTC 1 cut(s) 207
EarI CTCTTC 1 cut(s) 207
Eco81I CCTNAGG 1 cut(s) 299
FaeI CATG 1 cut(s) 343
FaiI YATR 7 cut(s) 24, 33, 221, 341, 423, 436, 438
FatI CATG 1 cut(s) 339
FokI GGATG 3 cut(s) 104, 217, 416
FspBI CTAG 2 cut(s) 15, 332
Hin1II CATG 1 cut(s) 343
HinfI GANTC 1 cut(s) 383
HphI GGTGA 1 cut(s) 400
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 3 cut(s) 227, 257, 367
HpyAV CCTTC 2 cut(s) 263, 366
HpyCH4V TGCA 1 cut(s) 267
HpyF3I CTNAG 3 cut(s) 10, 282, 299
Hsp92II CATG 1 cut(s) 343
Kzo9I GATC 2 cut(s) 174, 259
LmnI GCTCC 1 cut(s) 328
LpnPI CCDG 1 cut(s) 240
LweI GCATC 2 cut(s) 195, 399
MaeI CTAG 2 cut(s) 15, 332
MaeIII GTNAC 1 cut(s) 137
MalI GATC 2 cut(s) 176, 261
MboI GATC 2 cut(s) 174, 259
MboII GAAGA 1 cut(s) 224
MflI RGATCY 1 cut(s) 259
MluCI AATT 3 cut(s) 64, 244, 268
MmeI TCCRAC 1 cut(s) 60
MnlI CCTC 9 cut(s) 76, 96, 145, 153, 156, 165, 208, 260, 277
MseI TTAA 1 cut(s) 243
NdeII GATC 2 cut(s) 174, 259
NlaIII CATG 1 cut(s) 343
NlaIV GGNNCC 1 cut(s) 225
PcsI WCGNNNNNNNCGW 1 cut(s) 74
PfeI GAWTC 1 cut(s) 383
PspN4I GGNNCC 1 cut(s) 225
PsuI RGATCY 1 cut(s) 259
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 2 cut(s) 174, 259
SfaNI GCATC 2 cut(s) 195, 399
Sse9I AATT 3 cut(s) 64, 244, 268
SsiI CCGC 1 cut(s) 449
SspMI CTAG 2 cut(s) 15, 332
TaqI TCGA 1 cut(s) 177
TasI AATT 3 cut(s) 64, 244, 268
TfiI GAWTC 1 cut(s) 383
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspDTI ATGAA 1 cut(s) 195
XapI RAATTY 1 cut(s) 64
XspI CTAG 2 cut(s) 15, 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.