Rmu_sc0007069.1_g000021

Associates with the EF-Tu.GDP complex and induces the exchange of GDP to GTP. It remains bound to the aminoacyl-tRNA.EF- Tu.GTP complex up to the GTP hydrolysis stage on the ribosome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007069.1
Physical Location & Seq
Forward (+)
102439 .. 106889
4451 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007069.1_g000021.1.cds

Sequence Viewer

Length: 1176 bp
atggcttttcgtggaggtgcaaagcgttcccttggttcaatactgtgtagttatagatcgtcaactacagctactgctgctaatggccgaggtttttctacctgtgtctcaaacaaaagagctgtattttctcaagtcacagagacccaaacctcgattcctttgggacttgccaatccccaatgtgggtctgctctctttcttcttaggacgttgagtctgggagcatcgtcgtcttctgaccaaatgagtcttataaagcaactgaggcagagaactagtgctcctatcaaagatgtcaaggctgctctcattgattgcaattgggaaatcgaggatgcactgaaggaattgaggagaagagggaaggttttggcatcaaaaaagtcatcaagaatggcttccgagggtttgcttgcactggctcagaacgagagcagggctgccattatcgaactcaactgtgagactgactttgttgctagaaatgaaatctttcaatacttggcatcagctttggcaaagcaagctttgctggttgaaggctcttctcaacaggttcctggggtcattcccattgcctcggaacatttagaggacttgaagttaaatcttgaacatccaaaaattagtggagaaacaactgttcagaatgccattacggaagtggctgcagtaatgggggaaaatattaaacttagaaggggatttgttatgcctacagcttcacatggtgttgtttccacgtatctccatgcaagtccccaaccaggtttgggtcgcattgctggaattttatctctcgaagtagaggacaagagtgctccgttggatgccatccagcgcgttgggtcagaattggcaatgcatgtggtggctgcaaagcctttatttttaacaaaggaacatgtttcttctgatgcattagagagtgaacgggaaattctcaagtctcaggctgaaagtacgggcaagtctcagatggccatagacaaaatagtagaaggtcgtttgcgtaaatactacgaggaagttgttcttatggagcagaagtttattgtggacgattctgtaaatgtaaagacactattagataagctgtctaaggaagtgggatcacctgtgaagattgagagctttttcaggatggaagttggagaaggaattcaaaggtag

Protein Analysis

391

Amino Acids

42.42

Weight (kDa)

8.48

Isoelectric Point (pI)

44.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 257
AccII CGCG 1 cut(s) 846
AclWI GGATC 1 cut(s) 1123
AcoI YGGCCR 2 cut(s) 85, 984
AcsI RAATTY 3 cut(s) 792, 942, 1164
AcuI CTGAAG 1 cut(s) 365
AdeI CACNNNGTG 1 cut(s) 734
AfaI GTAC 1 cut(s) 967
AfiI CCNNNNNNNGG 4 cut(s) 185, 186, 770, 776
AflIII ACRYGT 1 cut(s) 907
AgsI TTSAA 6 cut(s) 39, 500, 542, 604, 617, 1169
AhdI GACNNNNNGTC 1 cut(s) 216
AhlI ACTAGT 1 cut(s) 278
AjnI CCWGG 2 cut(s) 562, 769
AjuI GAANNNNNNNTTGG 2 cut(s) 141, 173
AloI GAACNNNNNNTCC 2 cut(s) 268, 300
AluBI AGCT 7 cut(s) 71, 122, 515, 530, 725, 1099, 1137
AluI AGCT 7 cut(s) 71, 122, 515, 530, 725, 1099, 1137
Alw21I GWGCWC 2 cut(s) 286, 826
Alw26I GTCTC 5 cut(s) 112, 137, 461, 957, 981
AlwI GGATC 1 cut(s) 1123
AlwNI CAGNNNCTG 1 cut(s) 74
AoxI GGCC 2 cut(s) 85, 984
ApeKI GCWGC 5 cut(s) 77, 305, 443, 671, 878
ApoI RAATTY 3 cut(s) 792, 942, 1164
Asp700I GAANNNNTTC 4 cut(s) 400, 495, 1035, 1164
AspLEI GCGC 1 cut(s) 846
AsuHPI GGTGA 1 cut(s) 1110
BalI TGGCCA 1 cut(s) 986
BbsI GAAGAC 1 cut(s) 228
Bbv12I GWGCWC 2 cut(s) 286, 826
BbvI GCAGC 5 cut(s) 64, 292, 430, 658, 865
BccI CCATC 3 cut(s) 845, 976, 1141
BciT130I CCWGG 2 cut(s) 564, 771
BcoDI GTCTC 5 cut(s) 112, 137, 461, 957, 981
BcuI ACTAGT 1 cut(s) 278
BfaI CTAG 2 cut(s) 279, 483
BfmI CTRYAG 3 cut(s) 66, 672, 720
BisI GCNGC 5 cut(s) 78, 306, 444, 672, 879
BlsI GCNGC 5 cut(s) 79, 307, 445, 673, 880
Bme1390I CCNGG 2 cut(s) 564, 771
BmeRI GACNNNNNGTC 1 cut(s) 216
BmiI GGNNCC 1 cut(s) 561
BmrFI CCNGG 2 cut(s) 564, 771
BmsI GCATC 6 cut(s) 236, 328, 386, 518, 823, 910
BpiI GAAGAC 1 cut(s) 228
BpuEI CTTGAG 2 cut(s) 117, 932
BsaAI YACGTR 1 cut(s) 747
BsaI GGTCTC 1 cut(s) 137
BsaJI CCNNGG 5 cut(s) 31, 88, 405, 563, 582
BsaXI ACNNNNNCTCC 4 cut(s) 268, 298, 1037, 1067
Bsc4I CCNNNNNNNGG 4 cut(s) 185, 186, 770, 776
Bse1I ACTGG 1 cut(s) 426
Bse3DI GCAATG 3 cut(s) 576, 783, 870
BseBI CCWGG 2 cut(s) 564, 771
BseDI CCNNGG 5 cut(s) 31, 88, 405, 563, 582
BseGI GGATG 5 cut(s) 343, 619, 837, 838, 1152
BseLI CCNNNNNNNGG 4 cut(s) 185, 186, 770, 776
BseMI GCAATG 3 cut(s) 576, 783, 870
BseMII CTCAG 4 cut(s) 257, 440, 968, 992
BseNI ACTGG 1 cut(s) 426
BseRI GAGGAG 1 cut(s) 370
BseXI GCAGC 5 cut(s) 64, 292, 430, 658, 865
Bsh1236I CGCG 1 cut(s) 846
BshFI GGCC 2 cut(s) 87, 986
BsiHKAI GWGCWC 2 cut(s) 286, 826
BslFI GGGAC 2 cut(s) 180, 747
BslI CCNNNNNNNGG 4 cut(s) 185, 186, 770, 776
BsmAI GTCTC 5 cut(s) 112, 137, 461, 957, 981
BsmFI GGGAC 2 cut(s) 180, 747
BsmI GAATGC 1 cut(s) 658
BsnI GGCC 2 cut(s) 87, 986
Bso31I GGTCTC 1 cut(s) 137
Bsp1286I GDGCHC 2 cut(s) 286, 826
Bsp143I GATC 2 cut(s) 56, 1115
BspANI GGCC 2 cut(s) 87, 986
BspCNI CTCAG 4 cut(s) 258, 439, 967, 991
BspFNI CGCG 1 cut(s) 846
BspLI GGNNCC 1 cut(s) 561
BspMAI CTGCAG 1 cut(s) 676
BspPI GGATC 1 cut(s) 1123
BspQI GCTCTTC 1 cut(s) 553
BspTNI GGTCTC 1 cut(s) 137
BsrDI GCAATG 3 cut(s) 576, 783, 870
BsrI ACTGG 1 cut(s) 426
BssECI CCNNGG 5 cut(s) 31, 88, 405, 563, 582
BssMI GATC 2 cut(s) 56, 1115
BssT1I CCWWGG 1 cut(s) 31
Bst2UI CCWGG 2 cut(s) 564, 771
Bst4CI ACNGT 3 cut(s) 45, 464, 646
Bst6I CTCTTC 2 cut(s) 355, 553
BstAPI GCANNNNNTGC 1 cut(s) 532
BstBAI YACGTR 1 cut(s) 747
BstC8I GCNNGC 2 cut(s) 417, 528
BstDEI CTNAG 7 cut(s) 206, 266, 426, 698, 954, 978, 1104
BstF5I GGATG 5 cut(s) 343, 619, 837, 838, 1152
BstFNI CGCG 1 cut(s) 846
BstHHI GCGC 1 cut(s) 846
BstKTI GATC 2 cut(s) 59, 1118
BstMAI GTCTC 5 cut(s) 112, 137, 461, 957, 981
BstMBI GATC 2 cut(s) 56, 1115
BstMWI GCNNNNNNNGC 4 cut(s) 77, 268, 527, 532
BstNI CCWGG 2 cut(s) 564, 771
BstNSI RCATGY 2 cut(s) 872, 911
BstSCI CCNGG 2 cut(s) 562, 769
BstSFI CTRYAG 3 cut(s) 66, 672, 720
BstUI CGCG 1 cut(s) 846
BstV1I GCAGC 5 cut(s) 64, 292, 430, 658, 865
BstV2I GAAGAC 1 cut(s) 228
BstXI CCANNNNNNTGG 1 cut(s) 848
BsuRI GGCC 2 cut(s) 87, 986
BtsCI GGATG 5 cut(s) 343, 619, 837, 838, 1152
BtsIMutI CAGTG 2 cut(s) 341, 419
Cac8I GCNNGC 2 cut(s) 417, 528
CaiI CAGNNNCTG 1 cut(s) 74
CfoI GCGC 1 cut(s) 846
CsiI ACCWGGT 1 cut(s) 769
Csp6I GTAC 1 cut(s) 966
CspCI CAANNNNNGTGG 2 cut(s) 852, 887
CviAII CATG 4 cut(s) 731, 755, 869, 908
CviQI GTAC 1 cut(s) 966
DdeI CTNAG 7 cut(s) 206, 266, 426, 698, 954, 978, 1104
DpnI GATC 2 cut(s) 58, 1117
DpnII GATC 2 cut(s) 56, 1115
DraIII CACNNNGTG 1 cut(s) 734
DriI GACNNNNNGTC 1 cut(s) 216
EaeI YGGCCR 2 cut(s) 85, 984
Eam1104I CTCTTC 2 cut(s) 355, 553
Eam1105I GACNNNNNGTC 1 cut(s) 216
EarI CTCTTC 2 cut(s) 355, 553
Eco130I CCWWGG 1 cut(s) 31
Eco31I GGTCTC 1 cut(s) 137
Eco57I CTGAAG 1 cut(s) 365
EcoRI GAATTC 1 cut(s) 1164
EcoRII CCWGG 2 cut(s) 562, 769
EcoT14I CCWWGG 1 cut(s) 31
EcoT22I ATGCAT 2 cut(s) 870, 925
ErhI CCWWGG 1 cut(s) 31
FaeI CATG 4 cut(s) 734, 758, 872, 911
FaiI YATR 9 cut(s) 54, 257, 716, 732, 756, 870, 909, 989, 1043
FalI AAGNNNNNCTT 4 cut(s) 385, 417, 1023, 1055
FaqI GGGAC 2 cut(s) 180, 747
FatI CATG 4 cut(s) 730, 754, 868, 907
Fnu4HI GCNGC 5 cut(s) 78, 306, 444, 672, 879
FokI GGATG 5 cut(s) 350, 606, 824, 845, 1159
Fsp4HI GCNGC 5 cut(s) 78, 306, 444, 672, 879
FspBI CTAG 2 cut(s) 279, 483
GlaI GCGC 1 cut(s) 845
GluI GCNGC 5 cut(s) 78, 306, 444, 672, 879
HaeIII GGCC 2 cut(s) 87, 986
HhaI GCGC 1 cut(s) 846
Hin1II CATG 4 cut(s) 734, 758, 872, 911
Hin6I GCGC 1 cut(s) 844
HinP1I GCGC 1 cut(s) 844
HincII GTYRAC 1 cut(s) 63
HindII GTYRAC 1 cut(s) 63
HindIII AAGCTT 1 cut(s) 528
HinfI GANTC 4 cut(s) 157, 217, 250, 1067
HphI GGTGA 1 cut(s) 1110
Hpy166II GTNNAC 3 cut(s) 63, 935, 1063
Hpy188I TCNGA 8 cut(s) 241, 406, 429, 586, 651, 856, 919, 981
Hpy188III TCNNGA 4 cut(s) 393, 614, 803, 1144
Hpy8I GTNNAC 3 cut(s) 63, 935, 1063
Hpy99I CGWCG 1 cut(s) 235
HpyAV CCTTC 6 cut(s) 340, 361, 536, 696, 998, 1154
HpyCH4III ACNGT 3 cut(s) 45, 464, 646
HpyCH4IV ACGT 2 cut(s) 212, 746
HpyCH4V TGCA 9 cut(s) 20, 321, 341, 419, 674, 758, 868, 881, 923
HpyF10VI GCNNNNNNNGC 4 cut(s) 77, 268, 527, 532
HpyF3I CTNAG 7 cut(s) 206, 266, 426, 698, 954, 978, 1104
HpySE526I ACGT 2 cut(s) 212, 746
Hsp92II CATG 4 cut(s) 734, 758, 872, 911
HspAI GCGC 1 cut(s) 844
Kzo9I GATC 2 cut(s) 56, 1115
LguI GCTCTTC 1 cut(s) 553
LmnI GCTCC 4 cut(s) 224, 289, 829, 1045
Lsp1109I GCAGC 5 cut(s) 64, 292, 430, 658, 865
LweI GCATC 6 cut(s) 236, 328, 386, 518, 823, 910
MabI ACCWGGT 1 cut(s) 769
MaeI CTAG 2 cut(s) 279, 483
MaeII ACGT 2 cut(s) 212, 746
MaeIII GTNAC 1 cut(s) 136
MalI GATC 2 cut(s) 58, 1117
MboI GATC 2 cut(s) 56, 1115
MboII GAAGA 6 cut(s) 194, 228, 372, 540, 906, 1138
MfeI CAATTG 1 cut(s) 322
MhlI GDGCHC 2 cut(s) 286, 826
MlsI TGGCCA 1 cut(s) 986
MluCI AATT 7 cut(s) 322, 350, 627, 792, 857, 942, 1164
MluNI TGGCCA 1 cut(s) 986
MlyI GAGTC 2 cut(s) 226, 259
MmeI TCCRAC 2 cut(s) 810, 1135
Mox20I TGGCCA 1 cut(s) 986
Mph1103I ATGCAT 2 cut(s) 870, 925
MroXI GAANNNNTTC 4 cut(s) 400, 495, 1035, 1164
MscI TGGCCA 1 cut(s) 986
MseI TTAA 3 cut(s) 608, 693, 896
Msp20I TGGCCA 1 cut(s) 986
MspR9I CCNGG 2 cut(s) 564, 771
MunI CAATTG 1 cut(s) 322
Mva1269I GAATGC 1 cut(s) 658
MvaI CCWGG 2 cut(s) 564, 771
MvnI CGCG 1 cut(s) 846
MwoI GCNNNNNNNGC 4 cut(s) 77, 268, 527, 532
NdeII GATC 2 cut(s) 56, 1115
NlaIII CATG 4 cut(s) 734, 758, 872, 911
NlaIV GGNNCC 1 cut(s) 561
NmeAIII GCCGAG 1 cut(s) 113
NmuCI GTSAC 1 cut(s) 136
NsiI ATGCAT 2 cut(s) 870, 925
NspI RCATGY 2 cut(s) 872, 911
PciI ACATGT 1 cut(s) 907
PciSI GCTCTTC 1 cut(s) 553
PctI GAATGC 1 cut(s) 658
PdmI GAANNNNTTC 4 cut(s) 400, 495, 1035, 1164
PfeI GAWTC 2 cut(s) 157, 1067
PkrI GCNGC 5 cut(s) 79, 307, 445, 673, 880
PleI GAGTC 2 cut(s) 225, 258
PpsI GAGTC 2 cut(s) 225, 258
Ppu21I YACGTR 1 cut(s) 747
PscI ACATGT 1 cut(s) 907
PsiI TTATAA 1 cut(s) 257
Psp6I CCWGG 2 cut(s) 562, 769
PspGI CCWGG 2 cut(s) 562, 769
PspN4I GGNNCC 1 cut(s) 561
PstI CTGCAG 1 cut(s) 676
PstNI CAGNNNCTG 1 cut(s) 74
RsaI GTAC 1 cut(s) 967
RsaNI GTAC 1 cut(s) 966
SapI GCTCTTC 1 cut(s) 553
SaqAI TTAA 3 cut(s) 608, 693, 896
SatI GCNGC 5 cut(s) 78, 306, 444, 672, 879
Sau3AI GATC 2 cut(s) 56, 1115
SchI GAGTC 2 cut(s) 226, 259
ScrFI CCNGG 2 cut(s) 564, 771
SduI GDGCHC 2 cut(s) 286, 826
SexAI ACCWGGT 1 cut(s) 769
SfaNI GCATC 6 cut(s) 236, 328, 386, 518, 823, 910
SfcI CTRYAG 3 cut(s) 66, 672, 720
SmlI CTYRAG 2 cut(s) 132, 947
SmoI CTYRAG 2 cut(s) 132, 947
SpeI ACTAGT 1 cut(s) 278
Sse9I AATT 7 cut(s) 322, 350, 627, 792, 857, 942, 1164
SspI AATATT 1 cut(s) 691
SspMI CTAG 2 cut(s) 279, 483
StyD4I CCNGG 2 cut(s) 562, 769
StyI CCWWGG 1 cut(s) 31
TaaI ACNGT 3 cut(s) 45, 464, 646
TaiI ACGT 2 cut(s) 215, 749
TaqI TCGA 4 cut(s) 155, 333, 453, 804
TasI AATT 7 cut(s) 322, 350, 627, 792, 857, 942, 1164
TfiI GAWTC 2 cut(s) 157, 1067
Tru1I TTAA 3 cut(s) 608, 693, 896
Tru9I TTAA 3 cut(s) 608, 693, 896
TscAI CASTG 2 cut(s) 348, 426
TseFI GTSAC 1 cut(s) 136
TseI GCWGC 5 cut(s) 77, 305, 443, 671, 878
Tsp45I GTSAC 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 504
TspGWI ACGGA 2 cut(s) 677, 816
TspRI CASTG 2 cut(s) 348, 426
XapI RAATTY 3 cut(s) 792, 942, 1164
XceI RCATGY 2 cut(s) 872, 911
XcmI CCANNNNNNNNNTGG 1 cut(s) 664
XmnI GAANNNNTTC 4 cut(s) 400, 495, 1035, 1164
XspI CTAG 2 cut(s) 279, 483
Zsp2I ATGCAT 2 cut(s) 870, 925
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.