Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007090.1

Orthogroup ID

OG0008474

Physical Location & Seq

Genomic Coordinates Forward (+)

1154 .. 1699

Gene Structure 546 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007090.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 546 bp

atgggctctctatggagatcaagcattagtagtcccaagcttcccacagatcaagttccagcaccaaatgccacaacattgtggaaaaccattaccaaatccacaaacaccaacattcctaattcttcgaattccaatagacacaagctgagaaaatgtgcctccttaaaggttgcgacttcgtttactagggtttgtctttgtgcacccatatcttcctacaatgaggtttttagggctgagctcccaccaagaagaagcaatagttacccgagatcgaagccattggggatgacgacacaagatcaaagaagcattaccactatgagcgcgaggcttagcacttccgagagaagagtttttcgtgggaaatctctgacggaagacgttttgatgaggaggttcgttatggaagaagtagcaatgatgcacgttagaaggagaaatcaaatggaagtaataagaagaaaaagtataatgaggaggaagaatcttgggcctagtcgtcttagtagaatggttatggctggggaggaggataattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

181

Amino Acids

20.71

Weight (kDa)

11.46

Isoelectric Point (pI)

76.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008474)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G59680 AT3G59680
fragaria_vesca	FvH4_4g10370 FvH4_4g10370 FvH4_4g10370 FvH4_4g10370
malus_domestica	MD04G1049300.v1.1 MD17G1178000.v1.1
prunus_persica	Prupe.1G207500_v2.0.a1 Prupe.1G207500_v2.0.a1
pyrus_communis	pycom04g04350
rosa_chinensis	RchiOBHm_Chr4g0405921
rosa_laevigata	RLG00000008816
rosa_multiflora	Rmu_sc0006506.1_g000001 Rmu_sc0007090.1_g000001
rosa_roxburghii	Rroxscaffold_5G00350600
rosa_rugosa	Rorug04G0063700 Rorug04G0063800
rosa_samantha	Rh4AG134400 Rh4BG129600 Rh4CG142200 Rh4DG128900
rosa_wichuraiana	Rw4G010960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	332
AcsI	RAATTY	1 cut(s)	130
AluBI	AGCT	3 cut(s)	40, 148, 244
AluI	AGCT	3 cut(s)	40, 148, 244
Alw21I	GWGCWC	2 cut(s)	208, 246
Alw44I	GTGCAC	1 cut(s)	204
Ama87I	CYCGRG	1 cut(s)	271
AoxI	GGCC	1 cut(s)	497
ApaLI	GTGCAC	1 cut(s)	204
ApoI	RAATTY	1 cut(s)	130
AspLEI	GCGC	1 cut(s)	332
AspS9I	GGNCC	1 cut(s)	497
AsuII	TTCGAA	1 cut(s)	128
AvaI	CYCGRG	1 cut(s)	271
BaeGI	GKGCMC	1 cut(s)	208
BanII	GRGCYC	2 cut(s)	8, 246
BbsI	GAAGAC	1 cut(s)	390
Bbv12I	GWGCWC	2 cut(s)	208, 246
BfaI	CTAG	2 cut(s)	189, 501
BlpI	GCTNAGC	2 cut(s)	240, 338
BmeT110I	CYCGRG	1 cut(s)	271
BmgT120I	GGNCC	1 cut(s)	497
BmsI	GCATC	1 cut(s)	417
BpiI	GAAGAC	1 cut(s)	390
Bpu1102I	GCTNAGC	2 cut(s)	240, 338
Bpu14I	TTCGAA	1 cut(s)	128
Bse3DI	GCAATG	1 cut(s)	429
BseGI	GGATG	1 cut(s)	297
BseMI	GCAATG	1 cut(s)	429
BseMII	CTCAG	2 cut(s)	140, 231
BseRI	GAGGAG	2 cut(s)	412, 496
BseSI	GKGCMC	1 cut(s)	208
BseYI	CCCAGC	1 cut(s)	527
Bsh1236I	CGCG	1 cut(s)	332
BshFI	GGCC	1 cut(s)	499
BsiHKAI	GWGCWC	2 cut(s)	208, 246
BsiHKCI	CYCGRG	1 cut(s)	271
BslFI	GGGAC	1 cut(s)	18
BsmFI	GGGAC	1 cut(s)	18
BsnI	GGCC	1 cut(s)	499
BsoBI	CYCGRG	1 cut(s)	271
Bsp119I	TTCGAA	1 cut(s)	128
Bsp1286I	GDGCHC	3 cut(s)	8, 208, 246
Bsp143I	GATC	4 cut(s)	17, 49, 275, 304
Bsp1720I	GCTNAGC	2 cut(s)	240, 338
BspANI	GGCC	1 cut(s)	499
BspCNI	CTCAG	2 cut(s)	141, 232
BspFNI	CGCG	1 cut(s)	332
BspT104I	TTCGAA	1 cut(s)	128
BsrDI	GCAATG	1 cut(s)	429
BssMI	GATC	4 cut(s)	17, 49, 275, 304
Bst6I	CTCTTC	1 cut(s)	349
BstAPI	GCANNNNNTGC	1 cut(s)	68
BstBI	TTCGAA	1 cut(s)	128
BstDEI	CTNAG	4 cut(s)	149, 240, 338, 509
BstF5I	GGATG	1 cut(s)	297
BstFNI	CGCG	1 cut(s)	332
BstHHI	GCGC	1 cut(s)	332
BstKTI	GATC	4 cut(s)	20, 52, 278, 307
BstMBI	GATC	4 cut(s)	17, 49, 275, 304
BstMWI	GCNNNNNNNGC	1 cut(s)	68
BstSLI	GKGCMC	1 cut(s)	208
BstUI	CGCG	1 cut(s)	332
BstV2I	GAAGAC	1 cut(s)	390
BsuRI	GGCC	1 cut(s)	499
BtsCI	GGATG	1 cut(s)	297
CfoI	GCGC	1 cut(s)	332
Cfr13I	GGNCC	1 cut(s)	497
CviJI	RGCY	9 cut(s)	6, 40, 148, 239, 244, 283, 337, 499, 527
CviKI_1	RGCY	9 cut(s)	6, 40, 148, 239, 244, 283, 337, 499, 527
DdeI	CTNAG	4 cut(s)	149, 240, 338, 509
DpnI	GATC	4 cut(s)	19, 51, 277, 306
DpnII	GATC	4 cut(s)	17, 49, 275, 304
Eam1104I	CTCTTC	1 cut(s)	349
EarI	CTCTTC	1 cut(s)	349
Ecl136II	GAGCTC	1 cut(s)	244
Eco24I	GRGCYC	2 cut(s)	8, 246
Eco53kI	GAGCTC	1 cut(s)	244
Eco88I	CYCGRG	1 cut(s)	271
EcoICRI	GAGCTC	1 cut(s)	244
EcoRI	GAATTC	1 cut(s)	130
EcoT38I	GRGCYC	2 cut(s)	8, 246
FaiI	YATR	6 cut(s)	13, 212, 326, 410, 476, 524
FaqI	GGGAC	1 cut(s)	18
FokI	GGATG	1 cut(s)	304
FriOI	GRGCYC	2 cut(s)	8, 246
FspBI	CTAG	2 cut(s)	189, 501
GlaI	GCGC	1 cut(s)	331
GsaI	CCCAGC	1 cut(s)	531
HaeIII	GGCC	1 cut(s)	499
HhaI	GCGC	1 cut(s)	332
Hin6I	GCGC	1 cut(s)	330
HinP1I	GCGC	1 cut(s)	330
HindIII	AAGCTT	1 cut(s)	38
HinfI	GANTC	1 cut(s)	490
Hpy166II	GTNNAC	2 cut(s)	186, 206
Hpy188I	TCNGA	2 cut(s)	349, 378
Hpy8I	GTNNAC	2 cut(s)	186, 206
HpyAV	CCTTC	1 cut(s)	432
HpyCH4IV	ACGT	2 cut(s)	387, 432
HpyCH4V	TGCA	2 cut(s)	206, 430
HpyF10VI	GCNNNNNNNGC	1 cut(s)	68
HpyF3I	CTNAG	4 cut(s)	149, 240, 338, 509
HpySE526I	ACGT	2 cut(s)	387, 432
HspAI	GCGC	1 cut(s)	330
Kzo9I	GATC	4 cut(s)	17, 49, 275, 304
LmnI	GCTCC	1 cut(s)	249
LpnPI	CCDG	2 cut(s)	72, 513
LweI	GCATC	1 cut(s)	417
MaeI	CTAG	2 cut(s)	189, 501
MaeII	ACGT	2 cut(s)	387, 432
MaeIII	GTNAC	1 cut(s)	266
MalI	GATC	4 cut(s)	19, 51, 277, 306
MboI	GATC	4 cut(s)	17, 49, 275, 304
MboII	GAAGA	8 cut(s)	117, 207, 267, 366, 395, 425, 477, 499
MhlI	GDGCHC	3 cut(s)	8, 208, 246
MluCI	AATT	3 cut(s)	121, 130, 541
MnlI	CCTC	9 cut(s)	172, 220, 327, 390, 393, 474, 477, 526, 529
MseI	TTAA	1 cut(s)	167
MvnI	CGCG	1 cut(s)	332
MwoI	GCNNNNNNNGC	1 cut(s)	68
NdeII	GATC	4 cut(s)	17, 49, 275, 304
NspV	TTCGAA	1 cut(s)	128
PfeI	GAWTC	1 cut(s)	490
Psp124BI	GAGCTC	1 cut(s)	246
PspFI	CCCAGC	1 cut(s)	527
PspPI	GGNCC	1 cut(s)	497
SacI	GAGCTC	1 cut(s)	246
SaqAI	TTAA	1 cut(s)	167
Sau3AI	GATC	4 cut(s)	17, 49, 275, 304
Sau96I	GGNCC	1 cut(s)	497
SduI	GDGCHC	3 cut(s)	8, 208, 246
SetI	ASST	8 cut(s)	42, 150, 174, 231, 246, 390, 404, 435
SfaNI	GCATC	1 cut(s)	417
SfuI	TTCGAA	1 cut(s)	128
Sse9I	AATT	3 cut(s)	121, 130, 541
SspMI	CTAG	2 cut(s)	189, 501
SstI	GAGCTC	1 cut(s)	246
TaiI	ACGT	2 cut(s)	390, 435
TaqI	TCGA	2 cut(s)	128, 278
TasI	AATT	3 cut(s)	121, 130, 541
TfiI	GAWTC	1 cut(s)	490
Tru1I	TTAA	1 cut(s)	167
Tru9I	TTAA	1 cut(s)	167
TspGWI	ACGGA	1 cut(s)	395
VneI	GTGCAC	1 cut(s)	204
XapI	RAATTY	1 cut(s)	130
XspI	CTAG	2 cut(s)	189, 501

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.