Rmu_sc0007173.1_g000013

ABC transporter B family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007173.1
Physical Location & Seq
Forward (+)
55112 .. 59819
4708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007173.1_g000013.1.cds

Sequence Viewer

Length: 3771 bp
atggttcaacctcaaccccacgaagaactcatgcagaatatggaaaagaagaaacaagcaattgatgaggatgttgagacgaagggaagctcatccgaaacgttgggattcagtaagctgctaagctatgcggacggatgggattggattatgatgggattggggacgttgggttctgttgtccatggtatggcttttccagttggatatctactgctcggcagagcactcgatgcttttgggaacaatatcaacgacacacctgccatggttaaagcgctgaacaaggttattccatatgtgtggtacatggccttcgccacatttccggctggaatacttgaagttggatgctggatgtattcaagtgaaagacaagtggcacgtctaagactagcatatctaagagcagtgctcagccaggaggttggggctttcgatacagacttaaccagtggaaaagtgatcaccggaattagtaaccacactagtatcatacacagtgcaatcggagagacgttggggcattttctgtcaagtttcgcaactttcttttcggggattttgattgctgcaatatgctgttgggaagttgcactgcttaccttgttggttgttcctttgattcttgcaatcggagccacttataccaagaagatgaatgctgtctcggctgctaggatgctttacctggcggaagctacctctatggtagaacagaccatatgtcaaatcaaaacagtatatgcattcgttggagaaaactcggcaatcaaatctttctcaaactgcatggccaaacagtatttgctaagcaaaggggaggctctagtaaagggagttggaacaggaatgcttcaatctgtgaccttcatttcctgggctatcatcatttgggttggtgctgttgtagtcactgccaagagggcaagcggtggagatattatagccgctgtcatgtgcattctctttggagccatatcactcacttatgctgcgccggacatgcaagtcttcaatcaagcaaaggctgcaggaactgaagttttcaaggtgatcaatagaaagccagctataagttatgattcaccagggaaggaacttgacaagatttacggcaacattgacatacatgatgtttacttttcctacccttcccggcctgacagagccatccttcaaggcttttcattgtcaatcccagcaggaaaaactgtagcctttgtgggcagcagtggctgtggaaagagtactatcatctcactagtcgcaagattctatgatccgccaaaagggaagattctgattgacaaccacaacatcaaggatcttgacttgaaattcctgaggaaaaacataggagctgtttcgcaggaaccatcactgtttgcaggcaccattgcggacaacatgaaagtcggtaagatggatgcagaagatgtagagatccagaaagcatcagtgatggcaaatgcacacactttcatatctcaacttccagatcagtactccacagaggtaggacaaaggggagtccagttatctggaggccagaagcagagaatcgccatagcaagagccattctcaagaatcctcctattcttctgcttgatgaggcaacaagtgctcttgactcggagtctgagaaggtggttcaagaagcacttgacaaggctatgcaaggaaggacagtcatcttgatagcgcacagactatcaactattgttaatgcagatattattgcggttgtggaaaatggacaagtttcagaaacaggaactcaccggagcttacttgaaagcagcaaattctacaacaacttatttaacatgcagaacctcaacccagttcatgagtcgagagaagatggtccctctgaagaacatgaaagcatccgacaaaagaactcacctgaacagataacacgagctaaggagccccgcagcgaccggcatcctaatcagcctcccaagcaagatgaagaggaaataagaaaacaaaccatattcttcagaatctggtttggcttgaaaacgagagaactcgtaaagattgctattggttcttttgcagcagctttctctggcatatcaaagcctgtctttgggtattacattataacaataggagtagcatactaccacccagatgctaaaagaaaagtctcaaaatattcaatcaccttcgctctaattggattcatttcattgttctctcacaccttgcaacattacttctttggaatggttggagagaaggccatgacaaacctgagacgtgctctctattcaggtgtgctacgcaatgaaattggatggtatgagaaccctgagaatggcattggacagctcacctcaaggatcatcaatgacacttcaatggttaaactggtaattgctgaccggatgtctgtcattgttcagtgcatctcctccatactgattgcaaccattgtgagcatggttgtcaactggagaatggggttggtagcttgggctgtgatgccttgccacttcattggcggtctcattcaagccaagtctgccaagggttttgcaggagactcagctgctgcacataatgaacttgtttctcttgcttctgagtctgcacaaaacataagaaccgttgcgtcgttttgccatgaagatcatatactcaaaaaagccgaaatatctctggaaacacccaagagaatgagcaggaaagaaagtatcaagtatggcataattcagggagtttctctttgcttatggaacattgcacatgctgtggcattgtggtacacaacagttttggttcataaaaatcaatcgagcttcaaagatggcataagatcataccagattttctctctcacagtaccttcaatcacagaattgtggacattgattcccactgtaatttctgccatcaatgtactcactcctgcattcgagacccttgaccgcaaaactgaaatagatccatctacaccagaaacttcaaatcgggacagaatcatagggaacattgaatttcaaaacgttgagtttaattaccctttgagaccagaagtaactatcctgaacaacttcagtgtacaaattgaagctggtaaaaaggtggctcttgtcggtccaagtggagctggaaaatcttcagttctggcccttctgctaagattttatgatcccttgaaaggtaagatactcattgatggaaaggagataagggaatacaatttgagatggctgagaacacaaatagggttggtgcaacaagagcctcttctttttagctcctcaatcagacacaatatctgctacgggaacgaaagtgcttctgaaactgagattgtggaggtatcaaaggaagcaaacattgatgagttcataagtaatttgcctgatggatatgaaacagttgttggggagaagggatgccaactttcaggaggacaaaagcaaagaatagccatagctagaacactgctaaagaggcctgcaattttgcttctggatgaagcaacaagtgcccttgatgctgaatctgagaaatctgtggtgagtgcattggaagcgataaatttgaaaaagaatgggggcctgctgtcaaaaaccacacagattacagttgcacataggctttccacaataataaggtcggatatcattgttgtcatggacaaaggtgagattgtggagatgggatcccactcaaccctaataacagcatctgagggagtttattcaagattatatcagatacagagcatgggagaagagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

1256

Amino Acids

137.96

Weight (kDa)

7.58

Isoelectric Point (pI)

40.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012655)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2120
AarI CACCTGC 1 cut(s) 271
AasI GACNNNNNNGTC 1 cut(s) 1010
Acc36I ACCTGC 1 cut(s) 271
AccB1I GGYRCC 1 cut(s) 1394
AccB7I CCANNNNNTGG 1 cut(s) 190
AclI AACGTT 2 cut(s) 101, 3027
AclWI GGATC 8 cut(s) 1277, 1335, 1441, 2369, 2960, 3167, 3687, 3700
AcoI YGGCCR 1 cut(s) 795
AcsI RAATTY 4 cut(s) 1340, 1808, 3017, 3568
AcuI CTGAAG 5 cut(s) 1062, 1899, 1996, 3061, 3126
AfaI GTAC 7 cut(s) 308, 1252, 1508, 2786, 2865, 2922, 3084
AfeI AGCGCT 1 cut(s) 279
AfiI CCNNNNNNNGG 5 cut(s) 190, 1292, 2105, 2336, 3182
AhdI GACNNNNNGTC 3 cut(s) 726, 1639, 2407
AhlI ACTAGT 2 cut(s) 488, 1264
AjiI CACGTC 2 cut(s) 386, 2279
AjnI CCWGG 4 cut(s) 420, 690, 878, 1090
AjuI GAANNNNNNNTTGG 2 cut(s) 3393, 3425
AloI GAACNNNNNNTCC 2 cut(s) 157, 189
Alw21I GWGCWC 4 cut(s) 229, 417, 1630, 2284
Alw26I GTCTC 9 cut(s) 71, 509, 673, 2170, 2269, 2531, 2556, 2933, 3043
AlwI GGATC 8 cut(s) 1277, 1335, 1441, 2369, 2960, 3167, 3687, 3700
AlwNI CAGNNNCTG 5 cut(s) 1040, 1239, 2019, 2573, 3719
Aor51HI AGCGCT 1 cut(s) 279
AoxI GGCC 8 cut(s) 312, 795, 1160, 1549, 2259, 3150, 3482, 3586
ApoI RAATTY 4 cut(s) 1340, 1808, 3017, 3568
Asp700I GAANNNNTTC 2 cut(s) 3074, 3139
AspLEI GCGC 3 cut(s) 280, 1000, 1708
AspS9I GGNCC 4 cut(s) 1871, 3119, 3151, 3586
AsuC2I CCSGG 1 cut(s) 1159
AsuHPI GGTGA 9 cut(s) 460, 1066, 1080, 1775, 1902, 2173, 2344, 3559, 3686
AvaII GGWCC 2 cut(s) 1871, 3119
AxyI CCTNAGG 1 cut(s) 1346
BaeGI GKGCMC 1 cut(s) 3520
BaeI ACNNNNGTAYC 2 cut(s) 475, 508
BalI TGGCCA 1 cut(s) 797
BamHI GGATCC 1 cut(s) 3692
BanI GGYRCC 1 cut(s) 1394
BanII GRGCYC 1 cut(s) 1941
BarI GAAGNNNNNNTAC 4 cut(s) 299, 331, 2640, 2672
BauI CACGAG 1 cut(s) 1926
BbsI GAAGAC 1 cut(s) 1006
Bbv12I GWGCWC 4 cut(s) 229, 417, 1630, 2284
BceAI ACGGC 1 cut(s) 1132
BcgI CGANNNNNNTGC 4 cut(s) 211, 245, 245, 279
BciT130I CCWGG 4 cut(s) 422, 692, 880, 1092
BclI TGATCA 2 cut(s) 465, 1056
BcnI CCSGG 1 cut(s) 1159
BcoDI GTCTC 9 cut(s) 71, 509, 673, 2170, 2269, 2531, 2556, 2933, 3043
BcuI ACTAGT 2 cut(s) 488, 1264
BfaI CTAG 6 cut(s) 395, 489, 678, 830, 1265, 3465
BfmI CTRYAG 2 cut(s) 1032, 1215
BfoI RGCGCY 1 cut(s) 281
BfuAI ACCTGC 1 cut(s) 271
BglI GCCNNNNNGGC 1 cut(s) 926
BlpI GCTNAGC 3 cut(s) 122, 416, 812
BmcAI AGTACT 2 cut(s) 1252, 1508
Bme1390I CCNGG 5 cut(s) 422, 692, 880, 1092, 1159
Bme18I GGWCC 2 cut(s) 1871, 3119
BmeRI GACNNNNNGTC 3 cut(s) 726, 1639, 2407
BmgBI CACGTC 2 cut(s) 386, 2279
BmgT120I GGNCC 4 cut(s) 1871, 3119, 3151, 3586
BmiI GGNNCC 8 cut(s) 640, 976, 1377, 1396, 1873, 1938, 3587, 3694
BmrFI CCNGG 5 cut(s) 422, 692, 880, 1092, 1159
BmrI ACTGGG 1 cut(s) 1841
BmuI ACTGGG 1 cut(s) 1841
BpiI GAAGAC 1 cut(s) 1006
BplI GAGNNNNNCTC 6 cut(s) 399, 431, 1569, 1601, 2266, 2298
BpmI CTGGAG 2 cut(s) 1566, 2494
Bpu10I CCTNAGC 1 cut(s) 1932
Bpu1102I GCTNAGC 3 cut(s) 122, 416, 812
BpuEI CTTGAG 2 cut(s) 1571, 2341
BpuMI CCSGG 1 cut(s) 1159
BsaI GGTCTC 3 cut(s) 2531, 2933, 3043
BsaJI CCNNGG 5 cut(s) 184, 267, 879, 1091, 2547
BsaWI WCCGGW 3 cut(s) 470, 1785, 2403
Bsc4I CCNNNNNNNGG 5 cut(s) 190, 1292, 2105, 2336, 3182
Bse118I RCCGGY 1 cut(s) 1950
Bse1I ACTGG 6 cut(s) 200, 453, 1537, 1847, 2394, 2477
Bse21I CCTNAGG 1 cut(s) 1346
Bse3DI GCAATG 3 cut(s) 1398, 2311, 2760
BseBI CCWGG 4 cut(s) 422, 692, 880, 1092
BseDI CCNNGG 5 cut(s) 184, 267, 879, 1091, 2547
BseLI CCNNNNNNNGG 5 cut(s) 190, 1292, 2105, 2336, 3182
BseMI GCAATG 3 cut(s) 1398, 2311, 2760
BseNI ACTGG 6 cut(s) 200, 453, 1537, 1847, 2394, 2477
BseRI GAGGAG 2 cut(s) 2422, 3274
BseSI GKGCMC 1 cut(s) 3520
BseYI CCCAGC 1 cut(s) 1201
BsgI GTGCAG 2 cut(s) 2559, 2595
Bsh1285I CGRYCG 1 cut(s) 1951
BshFI GGCC 8 cut(s) 314, 797, 1162, 1551, 2261, 3152, 3484, 3588
BshNI GGYRCC 1 cut(s) 1394
BsiEI CGRYCG 1 cut(s) 1951
BsiHKAI GWGCWC 4 cut(s) 229, 417, 1630, 2284
BsiSI CCGG 7 cut(s) 329, 471, 1001, 1159, 1786, 1951, 2404
BslFI GGGAC 3 cut(s) 178, 1857, 3008
BslI CCNNNNNNNGG 5 cut(s) 190, 1292, 2105, 2336, 3182
BsmAI GTCTC 9 cut(s) 71, 509, 673, 2170, 2269, 2531, 2556, 2933, 3043
BsmBI CGTCTC 3 cut(s) 71, 509, 2269
BsmFI GGGAC 3 cut(s) 178, 1857, 3008
BsmI GAATGC 5 cut(s) 667, 749, 858, 963, 2933
BsnI GGCC 8 cut(s) 314, 797, 1162, 1551, 2261, 3152, 3484, 3588
Bso31I GGTCTC 3 cut(s) 2531, 2933, 3043
Bsp1286I GDGCHC 6 cut(s) 229, 417, 1630, 1941, 2284, 3520
Bsp1407I TGTACA 1 cut(s) 3082
Bsp1720I GCTNAGC 3 cut(s) 122, 416, 812
Bsp19I CCATGG 2 cut(s) 184, 267
BspANI GGCC 8 cut(s) 314, 797, 1162, 1551, 2261, 3152, 3484, 3588
BspHI TCATGA 1 cut(s) 1852
BspLI GGNNCC 8 cut(s) 640, 976, 1377, 1396, 1873, 1938, 3587, 3694
BspMAI CTGCAG 1 cut(s) 1036
BspMI ACCTGC 1 cut(s) 271
BspPI GGATC 8 cut(s) 1277, 1335, 1441, 2369, 2960, 3167, 3687, 3700
BspT107I GGYRCC 1 cut(s) 1394
BspTNI GGTCTC 3 cut(s) 2531, 2933, 3043
BsrDI GCAATG 3 cut(s) 1398, 2311, 2760
BsrFI RCCGGY 1 cut(s) 1950
BsrGI TGTACA 1 cut(s) 3082
BsrI ACTGG 6 cut(s) 200, 453, 1537, 1847, 2394, 2477
BssAI RCCGGY 1 cut(s) 1950
BssECI CCNNGG 5 cut(s) 184, 267, 879, 1091, 2547
BssSI CACGAG 1 cut(s) 1926
BssT1I CCWWGG 3 cut(s) 184, 267, 2547
Bst2BI CACGAG 1 cut(s) 1926
Bst2UI CCWGG 4 cut(s) 422, 692, 880, 1092
Bst6I CTCTTC 3 cut(s) 1977, 3276, 3759
BstAPI GCANNNNNTGC 4 cut(s) 233, 1031, 1625, 3515
BstAUI TGTACA 1 cut(s) 3082
BstC8I GCNNGC 5 cut(s) 931, 1071, 1393, 3486, 3590
BstDSI CCRYGG 2 cut(s) 184, 267
BstH2I RGCGCY 1 cut(s) 281
BstHHI GCGC 3 cut(s) 280, 1000, 1708
BstMAI GTCTC 9 cut(s) 71, 509, 673, 2170, 2269, 2531, 2556, 2933, 3043
BstMCI CGRYCG 1 cut(s) 1951
BstNI CCWGG 4 cut(s) 422, 692, 880, 1092
BstNSI RCATGY 3 cut(s) 1009, 1834, 2771
BstSCI CCNGG 5 cut(s) 420, 690, 878, 1090, 1157
BstSFI CTRYAG 2 cut(s) 1032, 1215
BstSLI GKGCMC 1 cut(s) 3520
BstV2I GAAGAC 1 cut(s) 1006
BstX2I RGATCY 4 cut(s) 1327, 1446, 2965, 3692
BstXI CCANNNNNNTGG 4 cut(s) 303, 428, 1544, 2519
BstYI RGATCY 4 cut(s) 1327, 1446, 2965, 3692
Bsu36I CCTNAGG 1 cut(s) 1346
BsuRI GGCC 8 cut(s) 314, 797, 1162, 1551, 2261, 3152, 3484, 3588
BtgI CCRYGG 2 cut(s) 184, 267
BtrI CACGTC 2 cut(s) 386, 2279
BtsI GCAGTG 5 cut(s) 417, 596, 915, 1240, 3470
BveI ACCTGC 1 cut(s) 271
Cac8I GCNNGC 5 cut(s) 931, 1071, 1393, 3486, 3590
CaiI CAGNNNCTG 5 cut(s) 1040, 1239, 2019, 2573, 3719
CciI TCATGA 1 cut(s) 1852
CfoI GCGC 3 cut(s) 280, 1000, 1708
Cfr10I RCCGGY 1 cut(s) 1950
Cfr13I GGNCC 4 cut(s) 1871, 3119, 3151, 3586
CseI GACGC 1 cut(s) 2622
Csp6I GTAC 7 cut(s) 307, 1251, 1507, 2785, 2864, 2921, 3083
CviQI GTAC 7 cut(s) 307, 1251, 1507, 2785, 2864, 2921, 3083
DrdI GACNNNNNNGTC 1 cut(s) 1010
DriI GACNNNNNGTC 3 cut(s) 726, 1639, 2407
DseDI GACNNNNNNGTC 1 cut(s) 1010
EaeI YGGCCR 1 cut(s) 795
Eam1104I CTCTTC 3 cut(s) 1977, 3276, 3759
Eam1105I GACNNNNNGTC 3 cut(s) 726, 1639, 2407
EarI CTCTTC 3 cut(s) 1977, 3276, 3759
EciI GGCGGA 2 cut(s) 710, 1275
Eco130I CCWWGG 3 cut(s) 184, 267, 2547
Eco147I AGGCCT 1 cut(s) 3484
Eco24I GRGCYC 1 cut(s) 1941
Eco31I GGTCTC 3 cut(s) 2531, 2933, 3043
Eco32I GATATC 2 cut(s) 209, 3652
Eco47I GGWCC 2 cut(s) 1871, 3119
Eco47III AGCGCT 1 cut(s) 279
Eco57I CTGAAG 5 cut(s) 1062, 1899, 1996, 3061, 3126
Eco81I CCTNAGG 1 cut(s) 1346
EcoO109I RGGNCCY 1 cut(s) 3586
EcoRII CCWGG 4 cut(s) 420, 690, 878, 1090
EcoRV GATATC 2 cut(s) 209, 3652
EcoT14I CCWWGG 3 cut(s) 184, 267, 2547
EcoT22I ATGCAT 1 cut(s) 751
EcoT38I GRGCYC 1 cut(s) 1941
ErhI CCWWGG 3 cut(s) 184, 267, 2547
Esp3I CGTCTC 3 cut(s) 71, 509, 2269
FalI AAGNNNNNCTT 6 cut(s) 1650, 1682, 2087, 2119, 3255, 3287
FaqI GGGAC 3 cut(s) 178, 1857, 3008
FauI CCCGC 1 cut(s) 1949
FauNDI CATATG 2 cut(s) 298, 725
FbaI TGATCA 2 cut(s) 465, 1056
FriOI GRGCYC 1 cut(s) 1941
FspBI CTAG 6 cut(s) 395, 489, 678, 830, 1265, 3465
GlaI GCGC 3 cut(s) 279, 999, 1707
GsaI CCCAGC 1 cut(s) 1205
GsuI CTGGAG 2 cut(s) 1566, 2494
HaeII RGCGCY 1 cut(s) 281
HaeIII GGCC 8 cut(s) 314, 797, 1162, 1551, 2261, 3152, 3484, 3588
HapII CCGG 7 cut(s) 329, 471, 1001, 1159, 1786, 1951, 2404
HgaI GACGC 1 cut(s) 2622
HhaI GCGC 3 cut(s) 280, 1000, 1708
Hin6I GCGC 3 cut(s) 278, 998, 1706
HinP1I GCGC 3 cut(s) 278, 998, 1706
HincII GTYRAC 1 cut(s) 2470
HindII GTYRAC 1 cut(s) 2470
HpaII CCGG 7 cut(s) 329, 471, 1001, 1159, 1786, 1951, 2404
HphI GGTGA 9 cut(s) 460, 1066, 1080, 1775, 1902, 2173, 2344, 3559, 3686
Hpy166II GTNNAC 5 cut(s) 1141, 2470, 2787, 2886, 3083
Hpy8I GTNNAC 5 cut(s) 1141, 2470, 2787, 2886, 3083
Hpy99I CGWCG 1 cut(s) 2638
HpyCH4IV ACGT 6 cut(s) 101, 167, 385, 518, 2278, 3027
HpySE526I ACGT 6 cut(s) 101, 167, 385, 518, 2278, 3027
HspAI GCGC 3 cut(s) 278, 998, 1706
Ksp22I TGATCA 2 cut(s) 465, 1056
LmnI GCTCC 7 cut(s) 638, 974, 1361, 1788, 1936, 3128, 3287
MaeI CTAG 6 cut(s) 395, 489, 678, 830, 1265, 3465
MaeII ACGT 6 cut(s) 101, 167, 385, 518, 2278, 3027
MaeIII GTNAC 4 cut(s) 479, 865, 913, 3058
MfeI CAATTG 1 cut(s) 60
MflI RGATCY 4 cut(s) 1327, 1446, 2965, 3692
MhlI GDGCHC 6 cut(s) 229, 417, 1630, 1941, 2284, 3520
MlsI TGGCCA 1 cut(s) 797
MluNI TGGCCA 1 cut(s) 797
MlyI GAGTC 6 cut(s) 1542, 1628, 1649, 1865, 2558, 2615
MmeI TCCRAC 7 cut(s) 184, 328, 736, 823, 1921, 2230, 3627
Mox20I TGGCCA 1 cut(s) 797
Mph1103I ATGCAT 1 cut(s) 751
MroXI GAANNNNTTC 2 cut(s) 3074, 3139
MscI TGGCCA 1 cut(s) 797
MseI TTAA 6 cut(s) 273, 449, 1728, 1827, 2385, 3036
MslI CAYNNNNRTG 3 cut(s) 301, 2148, 2378
Msp20I TGGCCA 1 cut(s) 797
MspA1I CMGCKG 2 cut(s) 953, 2570
MspI CCGG 7 cut(s) 329, 471, 1001, 1159, 1786, 1951, 2404
MspR9I CCNGG 5 cut(s) 422, 692, 880, 1092, 1159
MunI CAATTG 1 cut(s) 60
Mva1269I GAATGC 5 cut(s) 667, 749, 858, 963, 2933
MvaI CCWGG 4 cut(s) 422, 692, 880, 1092
NciI CCSGG 1 cut(s) 1159
NcoI CCATGG 2 cut(s) 184, 267
NdeI CATATG 2 cut(s) 298, 725
NlaIV GGNNCC 8 cut(s) 640, 976, 1377, 1396, 1873, 1938, 3587, 3694
NmeAIII GCCGAG 3 cut(s) 198, 650, 746
NmuCI GTSAC 2 cut(s) 865, 913
NsiI ATGCAT 1 cut(s) 751
NspI RCATGY 3 cut(s) 1009, 1834, 2771
PagI TCATGA 1 cut(s) 1852
PaqCI CACCTGC 1 cut(s) 271
PceI AGGCCT 1 cut(s) 3484
PctI GAATGC 5 cut(s) 667, 749, 858, 963, 2933
PdmI GAANNNNTTC 2 cut(s) 3074, 3139
PflMI CCANNNNNTGG 1 cut(s) 190
PleI GAGTC 6 cut(s) 1541, 1628, 1648, 1864, 2558, 2614
PpsI GAGTC 6 cut(s) 1541, 1628, 1648, 1864, 2558, 2614
PsiI TTATAA 1 cut(s) 2120
Psp1406I AACGTT 2 cut(s) 101, 3027
Psp6I CCWGG 4 cut(s) 420, 690, 878, 1090
PspFI CCCAGC 1 cut(s) 1201
PspGI CCWGG 4 cut(s) 420, 690, 878, 1090
PspN4I GGNNCC 8 cut(s) 640, 976, 1377, 1396, 1873, 1938, 3587, 3694
PspPI GGNCC 4 cut(s) 1871, 3119, 3151, 3586
PstI CTGCAG 1 cut(s) 1036
PstNI CAGNNNCTG 5 cut(s) 1040, 1239, 2019, 2573, 3719
PsuI RGATCY 4 cut(s) 1327, 1446, 2965, 3692
PvuII CAGCTG 1 cut(s) 2570
RsaI GTAC 7 cut(s) 308, 1252, 1508, 2786, 2865, 2922, 3084
RsaNI GTAC 7 cut(s) 307, 1251, 1507, 2785, 2864, 2921, 3083
RseI CAYNNNNRTG 3 cut(s) 301, 2148, 2378
SaqAI TTAA 6 cut(s) 273, 449, 1728, 1827, 2385, 3036
Sau96I GGNCC 4 cut(s) 1871, 3119, 3151, 3586
ScaI AGTACT 2 cut(s) 1252, 1508
SchI GAGTC 6 cut(s) 1542, 1628, 1649, 1865, 2558, 2615
ScrFI CCNGG 5 cut(s) 422, 692, 880, 1092, 1159
SduI GDGCHC 6 cut(s) 229, 417, 1630, 1941, 2284, 3520
SfcI CTRYAG 2 cut(s) 1032, 1215
SinI GGWCC 2 cut(s) 1871, 3119
SmiMI CAYNNNNRTG 3 cut(s) 301, 2148, 2378
SmlI CTYRAG 2 cut(s) 1586, 2356
SmoI CTYRAG 2 cut(s) 1586, 2356
SpeI ACTAGT 2 cut(s) 488, 1264
SseBI AGGCCT 1 cut(s) 3484
SspI AATATT 1 cut(s) 2174
SspMI CTAG 6 cut(s) 395, 489, 678, 830, 1265, 3465
StuI AGGCCT 1 cut(s) 3484
StyD4I CCNGG 5 cut(s) 420, 690, 878, 1090, 1157
StyI CCWWGG 3 cut(s) 184, 267, 2547
TaiI ACGT 6 cut(s) 104, 170, 388, 521, 2281, 3030
TaqI TCGA 5 cut(s) 231, 438, 1859, 2816, 2937
TaqII GACCGA 1 cut(s) 3107
TatI WGTACW 4 cut(s) 1250, 1506, 2920, 3082
TauI GCSGC 1 cut(s) 953
Tru1I TTAA 6 cut(s) 273, 449, 1728, 1827, 2385, 3036
Tru9I TTAA 6 cut(s) 273, 449, 1728, 1827, 2385, 3036
TseFI GTSAC 2 cut(s) 865, 913
Tsp45I GTSAC 2 cut(s) 865, 913
TspGWI ACGGA 1 cut(s) 150
Van91I CCANNNNNTGG 1 cut(s) 190
VpaK11BI GGWCC 2 cut(s) 1871, 3119
XapI RAATTY 4 cut(s) 1340, 1808, 3017, 3568
XceI RCATGY 3 cut(s) 1009, 1834, 2771
XcmI CCANNNNNNNNNTGG 1 cut(s) 2458
XmnI GAANNNNTTC 2 cut(s) 3074, 3139
XspI CTAG 6 cut(s) 395, 489, 678, 830, 1265, 3465
ZrmI AGTACT 2 cut(s) 1252, 1508
Zsp2I ATGCAT 1 cut(s) 751
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.