Rmu_sc0007300.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007300.1
Physical Location & Seq
Forward (+)
51957 .. 53195
1239 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007300.1_g000013.1.cds

Sequence Viewer

Length: 255 bp
atgcagaccaccaactccggcaacccagagctcgaggccgagctccgccgcaaagcccgacccgacactgtgatgatggggcaaacaaataaagaacgattggcagagtacctaggggagctgcagcggaaagagaacacaaatgaccgctatgttgctgcactgaaaggacagacattaactaggaatccatatgtgagaattcaaccagttccaaaggaaagcaacacggaatctaacaaggaacagaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.69

Weight (kDa)

9.39

Isoelectric Point (pI)

32.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012388)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 46, 49, 127, 148
AcsI RAATTY 1 cut(s) 201
AfaI GTAC 1 cut(s) 110
AgsI TTSAA 1 cut(s) 206
AluBI AGCT 3 cut(s) 31, 43, 121
AluI AGCT 3 cut(s) 31, 43, 121
Alw21I GWGCWC 2 cut(s) 33, 45
Ama87I CYCGRG 1 cut(s) 32
AoxI GGCC 1 cut(s) 36
ApeKI GCWGC 3 cut(s) 121, 124, 158
ApoI RAATTY 1 cut(s) 201
AspA2I CCTAGG 1 cut(s) 112
AvaI CYCGRG 1 cut(s) 32
AvrII CCTAGG 1 cut(s) 112
BanII GRGCYC 2 cut(s) 33, 45
Bbv12I GWGCWC 2 cut(s) 33, 45
BbvI GCAGC 3 cut(s) 108, 136, 145
BccI CCATC 1 cut(s) 70
BfaI CTAG 2 cut(s) 113, 183
BfmI CTRYAG 1 cut(s) 122
BisI GCNGC 4 cut(s) 49, 122, 125, 159
BlnI CCTAGG 1 cut(s) 112
BlsI GCNGC 4 cut(s) 50, 123, 126, 160
BmeT110I CYCGRG 1 cut(s) 32
BsaJI CCNNGG 1 cut(s) 112
Bse1I ACTGG 1 cut(s) 209
BseDI CCNNGG 1 cut(s) 112
BseNI ACTGG 1 cut(s) 209
BseXI GCAGC 3 cut(s) 108, 136, 145
BsgI GTGCAG 1 cut(s) 144
BshFI GGCC 1 cut(s) 38
BsiHKAI GWGCWC 2 cut(s) 33, 45
BsiHKCI CYCGRG 1 cut(s) 32
BsiSI CCGG 1 cut(s) 18
BsnI GGCC 1 cut(s) 38
BsoBI CYCGRG 1 cut(s) 32
Bsp1286I GDGCHC 2 cut(s) 33, 45
BspACI CCGC 4 cut(s) 46, 49, 127, 148
BspANI GGCC 1 cut(s) 38
BspMAI CTGCAG 1 cut(s) 126
BsrI ACTGG 1 cut(s) 209
BssECI CCNNGG 1 cut(s) 112
BssT1I CCWWGG 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 70
BstSFI CTRYAG 1 cut(s) 122
BstV1I GCAGC 3 cut(s) 108, 136, 145
BsuRI GGCC 1 cut(s) 38
BtsIMutI CAGTG 2 cut(s) 66, 161
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 5 cut(s) 31, 38, 43, 56, 121
CviKI_1 RGCY 5 cut(s) 31, 38, 43, 56, 121
CviQI GTAC 1 cut(s) 109
EciI GGCGGA 1 cut(s) 35
Ecl136II GAGCTC 2 cut(s) 31, 43
Eco130I CCWWGG 1 cut(s) 112
Eco24I GRGCYC 2 cut(s) 33, 45
Eco53kI GAGCTC 2 cut(s) 31, 43
Eco88I CYCGRG 1 cut(s) 32
EcoICRI GAGCTC 2 cut(s) 31, 43
EcoRI GAATTC 1 cut(s) 201
EcoT14I CCWWGG 1 cut(s) 112
EcoT38I GRGCYC 2 cut(s) 33, 45
ErhI CCWWGG 1 cut(s) 112
FaiI YATR 3 cut(s) 153, 193, 195
FauNDI CATATG 1 cut(s) 193
Fnu4HI GCNGC 4 cut(s) 49, 122, 125, 159
FriOI GRGCYC 2 cut(s) 33, 45
Fsp4HI GCNGC 4 cut(s) 49, 122, 125, 159
FspBI CTAG 2 cut(s) 113, 183
GluI GCNGC 4 cut(s) 49, 122, 125, 159
HaeIII GGCC 1 cut(s) 38
HapII CCGG 1 cut(s) 18
HinfI GANTC 2 cut(s) 187, 233
HpaII CCGG 1 cut(s) 18
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 3 cut(s) 4, 124, 161
LmnI GCTCC 2 cut(s) 48, 118
LpnPI CCDG 3 cut(s) 31, 39, 222
Lsp1109I GCAGC 3 cut(s) 108, 136, 145
MaeI CTAG 2 cut(s) 113, 183
MhlI GDGCHC 2 cut(s) 33, 45
MluCI AATT 1 cut(s) 201
MnlI CCTC 1 cut(s) 28
MseI TTAA 1 cut(s) 179
MslI CAYNNNNRTG 1 cut(s) 71
MspA1I CMGCKG 1 cut(s) 127
MspI CCGG 1 cut(s) 18
NdeI CATATG 1 cut(s) 193
NmeAIII GCCGAG 1 cut(s) 64
PaeR7I CTCGAG 1 cut(s) 32
PfeI GAWTC 2 cut(s) 187, 233
PkrI GCNGC 4 cut(s) 50, 123, 126, 160
Psp124BI GAGCTC 2 cut(s) 33, 45
PspXI VCTCGAGB 1 cut(s) 32
PstI CTGCAG 1 cut(s) 126
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 71
SacI GAGCTC 2 cut(s) 33, 45
SaqAI TTAA 1 cut(s) 179
SatI GCNGC 4 cut(s) 49, 122, 125, 159
SduI GDGCHC 2 cut(s) 33, 45
SetI ASST 4 cut(s) 33, 45, 114, 123
SfcI CTRYAG 1 cut(s) 122
Sfr274I CTCGAG 1 cut(s) 32
SlaI CTCGAG 1 cut(s) 32
SmiMI CAYNNNNRTG 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 1 cut(s) 201
SsiI CCGC 4 cut(s) 46, 49, 127, 148
SspMI CTAG 2 cut(s) 113, 183
SstI GAGCTC 2 cut(s) 33, 45
StyI CCWWGG 1 cut(s) 112
TaaI ACNGT 1 cut(s) 70
TaqI TCGA 1 cut(s) 33
TasI AATT 1 cut(s) 201
TauI GCSGC 1 cut(s) 51
TfiI GAWTC 2 cut(s) 187, 233
Tru1I TTAA 1 cut(s) 179
Tru9I TTAA 1 cut(s) 179
TscAI CASTG 2 cut(s) 73, 168
TseI GCWGC 3 cut(s) 121, 124, 158
TspGWI ACGGA 1 cut(s) 245
TspRI CASTG 2 cut(s) 73, 168
XapI RAATTY 1 cut(s) 201
XhoI CTCGAG 1 cut(s) 32
XmaJI CCTAGG 1 cut(s) 112
XspI CTAG 2 cut(s) 113, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.