Rmu_sc0007767.1_g000016

Protein of unknown function (DUF616)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007767.1
OG0011446
Physical Location & Seq
Reverse (-)
63516 .. 65943
2428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007767.1_g000016.1.cds

Sequence Viewer

Length: 1446 bp
atgtgtgacattgtgaacagaataaagaagagtataaaatcaaaggcgagcatccttaagaaatgtgtcatggggaaagtaacgtccactcctctgctctttcaatcaaagctggtctgtttctctctgctctacctcttcacctctctgtttctagctctctacacctctctctcccaaaccaaatgcctcttcagatcttcacctttcgacccaattcagccccctctcttctcctaccctcccaattatggagaacacaagtatgcaatcccaacccaacgtaaatcttgctcttcccctgtccatttctcagattattggaaggtcttgaaggagatccaaaatttgtgcaagaattcttcgtggaattcatcggttttgagttatatgcagggaaagtctgagacttttggagggaatttcagtacccaaaataggatttcctattttgttcattacaatgagagcactgaaatcccttgtgggttcctaaagaaatttccagtcagtgattctgatagaattgtcatggaagagtgtagaggacttgtagtagtctcggctatcttcaatgatcatgataaaattcgacaacccaaggggattggatcgaaaacccttgagaatgtatgtttctttatgtttatagatgagataaccctcaaaggattttaccagcatcatttgattccagaaaaatctgaaaactataggattggtgcatggagggttgtcaaggttttgagcaagggattgtatgagaatccggcaatgaatggtgtgataccaaagtacttggttcatagacttttcccaaacgccaaattcagcatttgggtggatgcgaaaatgcagctgatggttgatccattacttttgattcacacacttgttgtgaatgagaacgccgacatggcgatttcaaagcatccttactatgttcatactatggaagaagcaatggcgacggcgaggtggaagaaatggcgggacgttgatggattaaagaggcaaatggagacatattgtgaaaatggtttgctcccctggactcctgataagcttccttatccctcagatgtaccagatagtgctttgattctgaggaaacatggactgaggagcaatctattctcctgcctattgtttaatgagatggaggcattcaacccaagagaccaattagcctttgcatatgtgagagacctcatgagcccaaggctgaagctgaacatgttttcagttgaagtgtttgagcaaattgctgtggaatataggcacaaccttaaacctggagttgggaccagtggaggtgaatctaagggaggacccaaaaccaaaaagaccaaaagggcaggcaatgatttgttgtatgtcaatggcagctgttgcagcaagtgtcagaggtatcttttggagatgtggggggaatcccctggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF616

Protein Analysis

481

Amino Acids

55.06

Weight (kDa)

9.2

Isoelectric Point (pI)

34.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011446)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G46220
fragaria_vesca FvH4_3g05570 FvH4_3g05570
malus_domestica MD05G1284000.v1.1 MD10G1262300.v1.1
prunus_persica Prupe.4G080400_v2.0.a1 Prupe.4G080400_v2.0.a1
pyrus_communis pycom05g26310 pycom10g21850
rosa_chinensis RchiOBHm_Chr5g0014101
rosa_laevigata RLG00000032081
rosa_multiflora Rmu_sc0007767.1_g000016
rosa_roxburghii Rroxscaffold_1G00062530
rosa_rugosa Rorug05G0015700
rosa_samantha Rh5AG109600 Rh5BG106400 Rh5BG106500 Rh5CG118300 Rh5DG105100
rosa_wichuraiana Rw5G009570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 991
AclWI GGATC 3 cut(s) 334, 619, 863
AcsI RAATTY 7 cut(s) 346, 358, 370, 421, 500, 588, 827
AcuI CTGAAG 2 cut(s) 178, 1247
AfaI GTAC 3 cut(s) 430, 797, 1086
AfiI CCNNNNNNNGG 3 cut(s) 251, 438, 1301
AflII CTTAAG 1 cut(s) 56
AflIII ACRYGT 1 cut(s) 1236
AgsI TTSAA 6 cut(s) 104, 334, 574, 927, 1171, 1250
AjnI CCWGG 3 cut(s) 1049, 1294, 1438
AjuI GAANNNNNNNTTGG 2 cut(s) 176, 208
AluBI AGCT 6 cut(s) 112, 158, 859, 1066, 1231, 1389
AluI AGCT 6 cut(s) 112, 158, 859, 1066, 1231, 1389
Alw21I GWGCWC 1 cut(s) 473
Alw26I GTCTC 5 cut(s) 401, 565, 1016, 1173, 1200
AlwI GGATC 3 cut(s) 334, 619, 863
ApeKI GCWGC 3 cut(s) 856, 1386, 1395
ApoI RAATTY 7 cut(s) 346, 358, 370, 421, 500, 588, 827
AspS9I GGNCC 2 cut(s) 1305, 1331
AsuHPI GGTGA 3 cut(s) 133, 195, 1328
AvaII GGWCC 2 cut(s) 1305, 1331
BaeI ACNNNNGTAYC 2 cut(s) 779, 812
BanII GRGCYC 1 cut(s) 1220
Bbv12I GWGCWC 1 cut(s) 473
BbvI GCAGC 3 cut(s) 868, 1398, 1407
BccI CCATC 3 cut(s) 856, 995, 1153
BceAI ACGGC 1 cut(s) 987
BciT130I CCWGG 3 cut(s) 1051, 1296, 1440
BclI TGATCA 1 cut(s) 577
BcoDI GTCTC 5 cut(s) 401, 565, 1016, 1173, 1200
BfaI CTAG 1 cut(s) 155
BfmI CTRYAG 1 cut(s) 712
BfrI CTTAAG 1 cut(s) 56
BglI GCCNNNNNGGC 1 cut(s) 917
BglII AGATCT 1 cut(s) 197
BisI GCNGC 3 cut(s) 857, 1387, 1396
BlsI GCNGC 3 cut(s) 858, 1388, 1397
BmcAI AGTACT 1 cut(s) 797
Bme1390I CCNGG 3 cut(s) 1051, 1296, 1440
Bme18I GGWCC 2 cut(s) 1305, 1331
BmgT120I GGNCC 2 cut(s) 1305, 1331
BmiI GGNNCC 3 cut(s) 491, 1306, 1333
BmrFI CCNGG 3 cut(s) 1051, 1296, 1440
BmsI GCATC 4 cut(s) 60, 691, 835, 940
BpmI CTGGAG 1 cut(s) 1317
BpuEI CTTGAG 1 cut(s) 644
BsaI GGTCTC 2 cut(s) 1173, 1200
BsaJI CCNNGG 4 cut(s) 600, 1049, 1220, 1438
BsaXI ACNNNNNCTCC 2 cut(s) 73, 103
Bsc4I CCNNNNNNNGG 3 cut(s) 251, 438, 1301
Bse1I ACTGG 2 cut(s) 506, 1308
Bse3DI GCAATG 3 cut(s) 780, 969, 1369
BseBI CCWGG 3 cut(s) 1051, 1296, 1440
BseDI CCNNGG 4 cut(s) 600, 1049, 1220, 1438
BseGI GGATG 3 cut(s) 51, 850, 931
BseLI CCNNNNNNNGG 3 cut(s) 251, 438, 1301
BseMI GCAATG 3 cut(s) 780, 969, 1369
BseMII CTCAG 5 cut(s) 327, 396, 1092, 1097, 1112
BseNI ACTGG 2 cut(s) 506, 1308
BseRI GAGGAG 2 cut(s) 81, 1138
BseXI GCAGC 3 cut(s) 868, 1398, 1407
BsiHKAI GWGCWC 1 cut(s) 473
BsiSI CCGG 1 cut(s) 770
BslFI GGGAC 2 cut(s) 1007, 1318
BslI CCNNNNNNNGG 3 cut(s) 251, 438, 1301
BsmAI GTCTC 5 cut(s) 401, 565, 1016, 1173, 1200
BsmFI GGGAC 2 cut(s) 1007, 1318
BsmI GAATGC 1 cut(s) 1166
Bso31I GGTCTC 2 cut(s) 1173, 1200
Bsp1286I GDGCHC 2 cut(s) 473, 1220
Bsp143I GATC 5 cut(s) 197, 339, 577, 611, 868
BspACI CCGC 1 cut(s) 991
BspCNI CTCAG 5 cut(s) 326, 397, 1091, 1098, 1113
BspHI TCATGA 2 cut(s) 580, 1212
BspLI GGNNCC 3 cut(s) 491, 1306, 1333
BspPI GGATC 3 cut(s) 334, 619, 863
BspQI GCTCTTC 1 cut(s) 301
BspTI CTTAAG 1 cut(s) 56
BspTNI GGTCTC 2 cut(s) 1173, 1200
BsrDI GCAATG 3 cut(s) 780, 969, 1369
BsrI ACTGG 2 cut(s) 506, 1308
BssECI CCNNGG 4 cut(s) 600, 1049, 1220, 1438
BssMI GATC 5 cut(s) 197, 339, 577, 611, 868
BssT1I CCWWGG 2 cut(s) 600, 1220
Bst2UI CCWGG 3 cut(s) 1051, 1296, 1440
Bst6I CTCTTC 6 cut(s) 23, 143, 197, 236, 301, 531
BstAFI CTTAAG 1 cut(s) 56
BstAPI GCANNNNNTGC 1 cut(s) 1392
BstC8I GCNNGC 2 cut(s) 49, 1360
BstDEI CTNAG 6 cut(s) 313, 405, 1078, 1106, 1121, 1323
BstF5I GGATG 3 cut(s) 51, 850, 931
BstKTI GATC 5 cut(s) 200, 342, 580, 614, 871
BstMAI GTCTC 5 cut(s) 401, 565, 1016, 1173, 1200
BstMBI GATC 5 cut(s) 197, 339, 577, 611, 868
BstMWI GCNNNNNNNGC 3 cut(s) 917, 1392, 1395
BstNI CCWGG 3 cut(s) 1051, 1296, 1440
BstNSI RCATGY 1 cut(s) 1240
BstSCI CCNGG 3 cut(s) 1049, 1294, 1438
BstSFI CTRYAG 1 cut(s) 712
BstV1I GCAGC 3 cut(s) 868, 1398, 1407
BstX2I RGATCY 2 cut(s) 197, 339
BstYI RGATCY 2 cut(s) 197, 339
BtsCI GGATG 3 cut(s) 51, 850, 931
BtsIMutI CAGTG 3 cut(s) 471, 517, 1315
Cac8I GCNNGC 2 cut(s) 49, 1360
CciI TCATGA 2 cut(s) 580, 1212
Cfr13I GGNCC 2 cut(s) 1305, 1331
Csp6I GTAC 3 cut(s) 429, 796, 1085
CviAII CATG 8 cut(s) 70, 532, 581, 726, 916, 1115, 1213, 1237
CviQI GTAC 3 cut(s) 429, 796, 1085
DdeI CTNAG 6 cut(s) 313, 405, 1078, 1106, 1121, 1323
DpnI GATC 5 cut(s) 199, 341, 579, 613, 870
DpnII GATC 5 cut(s) 197, 339, 577, 611, 868
Eam1104I CTCTTC 6 cut(s) 23, 143, 197, 236, 301, 531
EarI CTCTTC 6 cut(s) 23, 143, 197, 236, 301, 531
Eco130I CCWWGG 2 cut(s) 600, 1220
Eco24I GRGCYC 1 cut(s) 1220
Eco31I GGTCTC 2 cut(s) 1173, 1200
Eco47I GGWCC 2 cut(s) 1305, 1331
Eco57I CTGAAG 2 cut(s) 178, 1247
EcoO109I RGGNCCY 1 cut(s) 1331
EcoRI GAATTC 2 cut(s) 358, 370
EcoRII CCWGG 3 cut(s) 1049, 1294, 1438
EcoT14I CCWWGG 2 cut(s) 600, 1220
EcoT38I GRGCYC 1 cut(s) 1220
ErhI CCWWGG 2 cut(s) 600, 1220
FaeI CATG 8 cut(s) 73, 535, 584, 729, 919, 1118, 1216, 1240
FaqI GGGAC 2 cut(s) 1007, 1318
FatI CATG 8 cut(s) 69, 531, 580, 725, 915, 1114, 1212, 1236
FauI CCCGC 1 cut(s) 984
FauNDI CATATG 1 cut(s) 1198
FbaI TGATCA 1 cut(s) 577
Fnu4HI GCNGC 3 cut(s) 857, 1387, 1396
FokI GGATG 3 cut(s) 38, 857, 918
FriOI GRGCYC 1 cut(s) 1220
Fsp4HI GCNGC 3 cut(s) 857, 1387, 1396
FspBI CTAG 1 cut(s) 155
GluI GCNGC 3 cut(s) 857, 1387, 1396
GsuI CTGGAG 1 cut(s) 1317
HapII CCGG 1 cut(s) 770
Hin1II CATG 8 cut(s) 73, 535, 584, 729, 919, 1118, 1216, 1240
HindIII AAGCTT 1 cut(s) 1064
HinfI GANTC 8 cut(s) 515, 691, 766, 883, 1054, 1102, 1319, 1433
HpaII CCGG 1 cut(s) 770
HphI GGTGA 3 cut(s) 133, 195, 1328
Hpy166II GTNNAC 2 cut(s) 16, 87
Hpy188I TCNGA 8 cut(s) 197, 316, 406, 520, 706, 1081, 1107, 1407
Hpy188III TCNNGA 5 cut(s) 331, 581, 695, 1058, 1213
Hpy8I GTNNAC 2 cut(s) 16, 87
Hpy99I CGWCG 1 cut(s) 973
HpyAV CCTTC 2 cut(s) 319, 328
HpyCH4IV ACGT 3 cut(s) 83, 283, 996
HpyCH4V TGCA 7 cut(s) 269, 354, 394, 725, 856, 1196, 1395
HpyF10VI GCNNNNNNNGC 3 cut(s) 917, 1392, 1395
HpyF3I CTNAG 6 cut(s) 313, 405, 1078, 1106, 1121, 1323
HpySE526I ACGT 3 cut(s) 83, 283, 996
Hsp92II CATG 8 cut(s) 73, 535, 584, 729, 919, 1118, 1216, 1240
Ksp22I TGATCA 1 cut(s) 577
Kzo9I GATC 5 cut(s) 197, 339, 577, 611, 868
LguI GCTCTTC 1 cut(s) 301
LmnI GCTCC 2 cut(s) 1050, 1125
Lsp1109I GCAGC 3 cut(s) 868, 1398, 1407
LweI GCATC 4 cut(s) 60, 691, 835, 940
MaeI CTAG 1 cut(s) 155
MaeII ACGT 3 cut(s) 83, 283, 996
MaeIII GTNAC 2 cut(s) 5, 79
MalI GATC 5 cut(s) 199, 341, 579, 613, 870
MboI GATC 5 cut(s) 197, 339, 577, 611, 868
MflI RGATCY 2 cut(s) 197, 339
MhlI GDGCHC 2 cut(s) 473, 1220
MlyI GAGTC 1 cut(s) 1048
MseI TTAA 4 cut(s) 57, 1007, 1152, 1290
MslI CAYNNNNRTG 3 cut(s) 264, 462, 839
MspA1I CMGCKG 2 cut(s) 859, 1389
MspCI CTTAAG 1 cut(s) 56
MspI CCGG 1 cut(s) 770
MspR9I CCNGG 3 cut(s) 1051, 1296, 1440
Mva1269I GAATGC 1 cut(s) 1166
MvaI CCWGG 3 cut(s) 1051, 1296, 1440
MwoI GCNNNNNNNGC 3 cut(s) 917, 1392, 1395
NdeI CATATG 1 cut(s) 1198
NdeII GATC 5 cut(s) 197, 339, 577, 611, 868
NlaIII CATG 8 cut(s) 73, 535, 584, 729, 919, 1118, 1216, 1240
NlaIV GGNNCC 3 cut(s) 491, 1306, 1333
NmeAIII GCCGAG 1 cut(s) 542
NmuCI GTSAC 1 cut(s) 5
NspI RCATGY 1 cut(s) 1240
PagI TCATGA 2 cut(s) 580, 1212
PciI ACATGT 1 cut(s) 1236
PciSI GCTCTTC 1 cut(s) 301
PctI GAATGC 1 cut(s) 1166
PfeI GAWTC 7 cut(s) 515, 691, 766, 883, 1102, 1319, 1433
PkrI GCNGC 3 cut(s) 858, 1388, 1397
PleI GAGTC 1 cut(s) 1048
PpsI GAGTC 1 cut(s) 1048
PpuMI RGGWCCY 1 cut(s) 1331
PscI ACATGT 1 cut(s) 1236
Psp5II RGGWCCY 1 cut(s) 1331
Psp6I CCWGG 3 cut(s) 1049, 1294, 1438
PspGI CCWGG 3 cut(s) 1049, 1294, 1438
PspN4I GGNNCC 3 cut(s) 491, 1306, 1333
PspPI GGNCC 2 cut(s) 1305, 1331
PspPPI RGGWCCY 1 cut(s) 1331
PsuI RGATCY 2 cut(s) 197, 339
PvuII CAGCTG 2 cut(s) 859, 1389
RsaI GTAC 3 cut(s) 430, 797, 1086
RsaNI GTAC 3 cut(s) 429, 796, 1085
RseI CAYNNNNRTG 3 cut(s) 264, 462, 839
SapI GCTCTTC 1 cut(s) 301
SaqAI TTAA 4 cut(s) 57, 1007, 1152, 1290
SatI GCNGC 3 cut(s) 857, 1387, 1396
Sau3AI GATC 5 cut(s) 197, 339, 577, 611, 868
Sau96I GGNCC 2 cut(s) 1305, 1331
ScaI AGTACT 1 cut(s) 797
SchI GAGTC 1 cut(s) 1048
ScrFI CCNGG 3 cut(s) 1051, 1296, 1440
SduI GDGCHC 2 cut(s) 473, 1220
SfaNI GCATC 4 cut(s) 60, 691, 835, 940
SfcI CTRYAG 1 cut(s) 712
SinI GGWCC 2 cut(s) 1305, 1331
SmiMI CAYNNNNRTG 3 cut(s) 264, 462, 839
SmlI CTYRAG 2 cut(s) 56, 623
SmoI CTYRAG 2 cut(s) 56, 623
SsiI CCGC 1 cut(s) 991
SspMI CTAG 1 cut(s) 155
StyD4I CCNGG 3 cut(s) 1049, 1294, 1438
StyI CCWWGG 2 cut(s) 600, 1220
TaiI ACGT 3 cut(s) 86, 286, 999
TaqI TCGA 3 cut(s) 210, 592, 614
TatI WGTACW 1 cut(s) 795
TfiI GAWTC 7 cut(s) 515, 691, 766, 883, 1102, 1319, 1433
Tru1I TTAA 4 cut(s) 57, 1007, 1152, 1290
Tru9I TTAA 4 cut(s) 57, 1007, 1152, 1290
TscAI CASTG 3 cut(s) 478, 517, 1315
TseFI GTSAC 1 cut(s) 5
TseI GCWGC 3 cut(s) 856, 1386, 1395
Tsp45I GTSAC 1 cut(s) 5
TspDTI ATGAA 5 cut(s) 363, 446, 791, 794, 935
TspRI CASTG 3 cut(s) 478, 517, 1315
Vha464I CTTAAG 1 cut(s) 56
VpaK11BI GGWCC 2 cut(s) 1305, 1331
XapI RAATTY 7 cut(s) 346, 358, 370, 421, 500, 588, 827
XceI RCATGY 1 cut(s) 1240
XspI CTAG 1 cut(s) 155
ZrmI AGTACT 1 cut(s) 797
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.