Rmu_sc0008269.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008269.1
Physical Location & Seq
Forward (+)
13 .. 765
753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008269.1_g000001.1.cds

Sequence Viewer

Length: 753 bp
atgtttaatagaatgacccgagaatacaaagtgaagccaacagttgcgcactattcatgtctggtggatgttctcggcagagcagggcgcttagatgaagcatatgaactcattaagactattgaagtagaacccagcagtgatatatgggctgcacttctctctgcttgcaggctatatccaaatgtcaagctggcggagatttcagcacagaagattttcgaaatgaacccagagggagtgggtagttacatttgtctttccaatatctatgccgctgagaagcgatgggatgatgtggaaagagtgagagccatggtgagaaagaagggactgaagaaaccacctggctgcacttttgtggagttagacaagatggttcatcggttcttagttggggataagtcgcacccacaaacagaggatatttatgccaagttaaaagacttgaacctgcgactcagggaggttggatacaagcctgataccacttctgtgttgtatgatgtaggagaagaaatgaaggagaagatgctttgggatcatagtgaaagattggcaattgcatttgcccttattaacacaagaccagggaccacaatcaggatctccaagaatcttcgtatctgtgttgattgccacacggtaacgaaaatgatttctaaattcacggctcgagagattataatgcgagataaccataggttccaccattttagagatggattttgctcttgtggtgattattggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

250

Amino Acids

28.96

Weight (kDa)

8.82

Isoelectric Point (pI)

35.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 686
Acc16I TGCGCA 1 cut(s) 48
Acc36I ACCTGC 1 cut(s) 462
AciI CCGC 2 cut(s) 197, 276
AclWI GGATC 2 cut(s) 549, 614
AcsI RAATTY 1 cut(s) 665
AcuI CTGAAG 1 cut(s) 356
AfiI CCNNNNNNNGG 1 cut(s) 603
AgsI TTSAA 2 cut(s) 125, 451
AjnI CCWGG 2 cut(s) 346, 589
AleI CACNNNNGTG 2 cut(s) 359, 494
AluBI AGCT 1 cut(s) 193
AluI AGCT 1 cut(s) 193
AlwI GGATC 2 cut(s) 549, 614
Ama87I CYCGRG 2 cut(s) 18, 675
ApeKI GCWGC 2 cut(s) 152, 351
ApoI RAATTY 1 cut(s) 665
Asp700I GAANNNNTTC 1 cut(s) 218
AspLEI GCGC 2 cut(s) 49, 90
AspS9I GGNCC 1 cut(s) 594
AsuHPI GGTGA 2 cut(s) 331, 752
AsuII TTCGAA 1 cut(s) 222
AvaI CYCGRG 2 cut(s) 18, 675
AvaII GGWCC 1 cut(s) 594
BbvI GCAGC 2 cut(s) 139, 338
BccI CCATC 3 cut(s) 282, 370, 716
BceAI ACGGC 1 cut(s) 687
BciT130I CCWGG 2 cut(s) 348, 591
BciVI GTATCC 1 cut(s) 467
BfoI RGCGCY 1 cut(s) 91
BfuAI ACCTGC 1 cut(s) 462
BfuI GTATCC 1 cut(s) 467
BisI GCNGC 3 cut(s) 153, 276, 352
BlsI GCNGC 3 cut(s) 154, 277, 353
Bme1390I CCNGG 2 cut(s) 348, 591
Bme18I GGWCC 1 cut(s) 594
BmeT110I CYCGRG 2 cut(s) 18, 675
BmgT120I GGNCC 1 cut(s) 594
BmiI GGNNCC 2 cut(s) 595, 707
BmrFI CCNGG 2 cut(s) 348, 591
BmsI GCATC 1 cut(s) 522
Bpu14I TTCGAA 1 cut(s) 222
BsaJI CCNNGG 2 cut(s) 315, 590
Bsc4I CCNNNNNNNGG 1 cut(s) 603
BseBI CCWGG 2 cut(s) 348, 591
BseDI CCNNGG 2 cut(s) 315, 590
BseGI GGATG 2 cut(s) 73, 298
BseLI CCNNNNNNNGG 1 cut(s) 603
BseMII CTCAG 2 cut(s) 270, 475
BseXI GCAGC 2 cut(s) 139, 338
BseYI CCCAGC 1 cut(s) 134
BsgI GTGCAG 2 cut(s) 138, 337
BsiHKCI CYCGRG 2 cut(s) 18, 675
BslFI GGGAC 2 cut(s) 345, 607
BslI CCNNNNNNNGG 1 cut(s) 603
BsmFI GGGAC 2 cut(s) 345, 607
BsoBI CYCGRG 2 cut(s) 18, 675
Bsp119I TTCGAA 1 cut(s) 222
Bsp143I GATC 2 cut(s) 541, 606
Bsp19I CCATGG 1 cut(s) 315
BspACI CCGC 2 cut(s) 197, 276
BspCNI CTCAG 2 cut(s) 271, 474
BspLI GGNNCC 2 cut(s) 595, 707
BspMI ACCTGC 1 cut(s) 462
BspPI GGATC 2 cut(s) 549, 614
BspT104I TTCGAA 1 cut(s) 222
BssECI CCNNGG 2 cut(s) 315, 590
BssMI GATC 2 cut(s) 541, 606
BssT1I CCWWGG 1 cut(s) 315
Bst2UI CCWGG 2 cut(s) 348, 591
Bst4CI ACNGT 2 cut(s) 43, 646
BstBI TTCGAA 1 cut(s) 222
BstC8I GCNNGC 3 cut(s) 169, 173, 195
BstDEI CTNAG 4 cut(s) 91, 279, 391, 461
BstDSI CCRYGG 1 cut(s) 315
BstF5I GGATG 2 cut(s) 73, 298
BstH2I RGCGCY 1 cut(s) 91
BstHHI GCGC 2 cut(s) 49, 90
BstKTI GATC 2 cut(s) 544, 609
BstMBI GATC 2 cut(s) 541, 606
BstNI CCWGG 2 cut(s) 348, 591
BstSCI CCNGG 2 cut(s) 346, 589
BstV1I GCAGC 2 cut(s) 139, 338
BstX2I RGATCY 1 cut(s) 606
BstYI RGATCY 1 cut(s) 606
BsuI GTATCC 1 cut(s) 467
BtgI CCRYGG 1 cut(s) 315
BtgZI GCGATG 1 cut(s) 301
BtsCI GGATG 2 cut(s) 73, 298
BtsI GCAGTG 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 145
BveI ACCTGC 1 cut(s) 462
Cac8I GCNNGC 3 cut(s) 169, 173, 195
CfoI GCGC 2 cut(s) 49, 90
Cfr13I GGNCC 1 cut(s) 594
CviAII CATG 2 cut(s) 57, 316
CviJI RGCY 8 cut(s) 37, 152, 175, 193, 314, 351, 481, 674
CviKI_1 RGCY 8 cut(s) 37, 152, 175, 193, 314, 351, 481, 674
DdeI CTNAG 4 cut(s) 91, 279, 391, 461
DpnI GATC 2 cut(s) 543, 608
DpnII GATC 2 cut(s) 541, 606
EciI GGCGGA 1 cut(s) 212
Eco130I CCWWGG 1 cut(s) 315
Eco47I GGWCC 1 cut(s) 594
Eco57I CTGAAG 1 cut(s) 356
Eco88I CYCGRG 2 cut(s) 18, 675
EcoRII CCWGG 2 cut(s) 346, 589
EcoT14I CCWWGG 1 cut(s) 315
ErhI CCWWGG 1 cut(s) 315
FaeI CATG 2 cut(s) 60, 319
FaqI GGGAC 2 cut(s) 345, 607
FatI CATG 2 cut(s) 56, 315
FauNDI CATATG 1 cut(s) 103
Fnu4HI GCNGC 3 cut(s) 153, 276, 352
FokI GGATG 2 cut(s) 80, 305
Fsp4HI GCNGC 3 cut(s) 153, 276, 352
FspI TGCGCA 1 cut(s) 48
GlaI GCGC 2 cut(s) 48, 89
GluI GCNGC 3 cut(s) 153, 276, 352
GsaI CCCAGC 1 cut(s) 138
HaeII RGCGCY 1 cut(s) 91
HhaI GCGC 2 cut(s) 49, 90
Hin1II CATG 2 cut(s) 60, 319
Hin6I GCGC 2 cut(s) 47, 88
HinP1I GCGC 2 cut(s) 47, 88
HinfI GANTC 2 cut(s) 459, 616
HphI GGTGA 2 cut(s) 331, 752
Hpy188III TCNNGA 2 cut(s) 604, 677
HpyAV CCTTC 2 cut(s) 322, 517
HpyCH4III ACNGT 2 cut(s) 43, 646
HpyCH4V TGCA 4 cut(s) 155, 171, 354, 566
HpyF3I CTNAG 4 cut(s) 91, 279, 391, 461
Hsp92II CATG 2 cut(s) 60, 319
HspAI GCGC 2 cut(s) 47, 88
Kzo9I GATC 2 cut(s) 541, 606
Lsp1109I GCAGC 2 cut(s) 139, 338
LweI GCATC 1 cut(s) 522
MaeIII GTNAC 2 cut(s) 248, 646
MalI GATC 2 cut(s) 543, 608
MboI GATC 2 cut(s) 541, 606
MboII GAAGA 5 cut(s) 226, 349, 527, 541, 611
MfeI CAATTG 1 cut(s) 561
MflI RGATCY 1 cut(s) 606
MluCI AATT 2 cut(s) 561, 665
MlyI GAGTC 1 cut(s) 453
MmeI TCCRAC 1 cut(s) 451
MnlI CCTC 3 cut(s) 229, 415, 460
MroXI GAANNNNTTC 1 cut(s) 218
MseI TTAA 4 cut(s) 6, 114, 440, 579
MslI CAYNNNNRTG 2 cut(s) 359, 494
MspA1I CMGCKG 1 cut(s) 278
MspR9I CCNGG 2 cut(s) 348, 591
MunI CAATTG 1 cut(s) 561
MvaI CCWGG 2 cut(s) 348, 591
NcoI CCATGG 1 cut(s) 315
NdeI CATATG 1 cut(s) 103
NdeII GATC 2 cut(s) 541, 606
NlaIII CATG 2 cut(s) 60, 319
NlaIV GGNNCC 2 cut(s) 595, 707
NmeAIII GCCGAG 1 cut(s) 54
NsbI TGCGCA 1 cut(s) 48
NspV TTCGAA 1 cut(s) 222
OliI CACNNNNGTG 2 cut(s) 359, 494
PaeR7I CTCGAG 1 cut(s) 675
PdmI GAANNNNTTC 1 cut(s) 218
PfeI GAWTC 1 cut(s) 616
PkrI GCNGC 3 cut(s) 154, 277, 353
PleI GAGTC 1 cut(s) 453
PpsI GAGTC 1 cut(s) 453
PsiI TTATAA 1 cut(s) 686
Psp6I CCWGG 2 cut(s) 346, 589
PspFI CCCAGC 1 cut(s) 134
PspGI CCWGG 2 cut(s) 346, 589
PspN4I GGNNCC 2 cut(s) 595, 707
PspPI GGNCC 1 cut(s) 594
PsuI RGATCY 1 cut(s) 606
RseI CAYNNNNRTG 2 cut(s) 359, 494
SaqAI TTAA 4 cut(s) 6, 114, 440, 579
SatI GCNGC 3 cut(s) 153, 276, 352
Sau3AI GATC 2 cut(s) 541, 606
Sau96I GGNCC 1 cut(s) 594
SchI GAGTC 1 cut(s) 453
ScrFI CCNGG 2 cut(s) 348, 591
SetI ASST 5 cut(s) 195, 349, 456, 471, 707
SfaNI GCATC 1 cut(s) 522
Sfr274I CTCGAG 1 cut(s) 675
SfuI TTCGAA 1 cut(s) 222
SinI GGWCC 1 cut(s) 594
SlaI CTCGAG 1 cut(s) 675
SmiMI CAYNNNNRTG 2 cut(s) 359, 494
SmlI CTYRAG 1 cut(s) 675
SmoI CTYRAG 1 cut(s) 675
Sse9I AATT 2 cut(s) 561, 665
SsiI CCGC 2 cut(s) 197, 276
StyD4I CCNGG 2 cut(s) 346, 589
StyI CCWWGG 1 cut(s) 315
TaaI ACNGT 2 cut(s) 43, 646
TaqI TCGA 2 cut(s) 222, 676
TasI AATT 2 cut(s) 561, 665
TauI GCSGC 1 cut(s) 278
TfiI GAWTC 1 cut(s) 616
Tru1I TTAA 4 cut(s) 6, 114, 440, 579
Tru9I TTAA 4 cut(s) 6, 114, 440, 579
TscAI CASTG 1 cut(s) 145
TseI GCWGC 2 cut(s) 152, 351
TspDTI ATGAA 6 cut(s) 45, 111, 120, 242, 371, 536
TspRI CASTG 1 cut(s) 145
VpaK11BI GGWCC 1 cut(s) 594
XapI RAATTY 1 cut(s) 665
XcmI CCANNNNNNNNNTGG 1 cut(s) 719
XhoI CTCGAG 1 cut(s) 675
XmnI GAANNNNTTC 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.