Rorug02G0275700

DYW family of nucleic acid deaminases

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
29584445 .. 29587946
3502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0275700.1

Sequence Viewer

Length: 216 bp
ATGAATTCTATTCAATGGTCTATGATCACTGCATTGCTCATCTTCCCGCTTCTTCATCTCCCCTCTTGCATTTCCATTGATTCCATTATTCCAAACCAAACCATCAAAGACGGCGACGTTTTAGTCTCAAGCAGGAAGCTCTTTGTGCTAGGGTTCTTCAGCCCTGGAAATTCTGGCAAACGTTACGTTGGAGTTTGGTATAACAAACACTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.03

Weight (kDa)

9.36

Isoelectric Point (pI)

42.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 122
AciI CCGC 1 cut(s) 47
AclI AACGTT 1 cut(s) 181
AcsI RAATTY 2 cut(s) 4, 169
AcuI CTGAAG 1 cut(s) 142
AgsI TTSAA 1 cut(s) 14
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
Alw26I GTCTC 1 cut(s) 130
ApoI RAATTY 2 cut(s) 4, 169
BccI CCATC 1 cut(s) 110
BceAI ACGGC 1 cut(s) 127
BciT130I CCWGG 1 cut(s) 165
BclI TGATCA 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 130
BfaI CTAG 2 cut(s) 149, 214
Bme1390I CCNGG 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 112
BsaJI CCNNGG 1 cut(s) 163
Bse3DI GCAATG 1 cut(s) 32
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 163
BseMI GCAATG 1 cut(s) 32
BsmAI GTCTC 1 cut(s) 130
Bsp143I GATC 1 cut(s) 24
BspACI CCGC 1 cut(s) 47
BsrDI GCAATG 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 1 cut(s) 24
Bst2UI CCWGG 1 cut(s) 165
BstKTI GATC 1 cut(s) 27
BstMAI GTCTC 1 cut(s) 130
BstMBI GATC 1 cut(s) 24
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BtsI GCAGTG 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 27
CviJI RGCY 2 cut(s) 139, 162
CviKI_1 RGCY 2 cut(s) 139, 162
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
DrdI GACNNNNNNGTC 1 cut(s) 122
DseDI GACNNNNNNGTC 1 cut(s) 122
Eco57I CTGAAG 1 cut(s) 142
EcoRI GAATTC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 163
FaiI YATR 2 cut(s) 23, 201
FauI CCCGC 1 cut(s) 54
FbaI TGATCA 1 cut(s) 24
FspBI CTAG 2 cut(s) 149, 214
HinfI GANTC 1 cut(s) 80
Hpy99I CGWCG 1 cut(s) 119
HpyCH4IV ACGT 3 cut(s) 117, 181, 186
HpyCH4V TGCA 2 cut(s) 32, 69
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpySE526I ACGT 3 cut(s) 117, 181, 186
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 4 cut(s) 118, 150, 159, 177
MaeI CTAG 2 cut(s) 149, 214
MaeII ACGT 3 cut(s) 117, 181, 186
MaeIII GTNAC 1 cut(s) 182
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 3 cut(s) 34, 44, 148
MluCI AATT 2 cut(s) 4, 169
MmeI TCCRAC 1 cut(s) 169
MnlI CCTC 1 cut(s) 73
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 80
Psp1406I AACGTT 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
Sau3AI GATC 1 cut(s) 24
ScrFI CCNGG 1 cut(s) 165
SetI ASST 4 cut(s) 120, 141, 184, 189
SgeI CNNG 8 cut(s) 58, 78, 141, 145, 161, 176, 177, 186
SmlI CTYRAG 1 cut(s) 127
SmoI CTYRAG 1 cut(s) 127
Sse9I AATT 2 cut(s) 4, 169
SsiI CCGC 1 cut(s) 47
SspMI CTAG 2 cut(s) 149, 214
StyD4I CCNGG 1 cut(s) 163
TaiI ACGT 3 cut(s) 120, 184, 189
TasI AATT 2 cut(s) 4, 169
TfiI GAWTC 1 cut(s) 80
TscAI CASTG 1 cut(s) 34
TspDTI ATGAA 2 cut(s) 17, 44
TspRI CASTG 1 cut(s) 34
XapI RAATTY 2 cut(s) 4, 169
XspI CTAG 2 cut(s) 149, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.