Rmu_sc0008324.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008324.1
OG0011176
Physical Location & Seq
Forward (+)
7384 .. 8223
840 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008324.1_g000003.1.cds

Sequence Viewer

Length: 840 bp
ctgtcttcctgggatccctcatctgacacatacgcccccacagacagtgccagtgataactttttgaataaaactaccaacatatttgaaaccctttcctctgctaccactgccgaagcaccagataccaacagtgaaaagcttaatggcgcaagtaatcagacaggaaccgagcttcaggtcctcaaatggccaatgtggcttctgggcccttcttttctcctcctcactggcatgttgccaacactgtggctaccaatatcttccatatttcttggccccaacatagcaagcctacttgctttggtcggacttgattgcatttttaatcttggtgcaaccctttttctcctcatggctgattcgatagcccggcctaaaacttcagcactggcctgcaaaagcaaacctccctttagctacaagttttggaatatagttgcaactgtgactggatttatcatccccctgatgatggcttatggatcccaacagggtttccttcaaccccagttgcctcccatctcatttgcagttctattgggtccctatcttctgcttatcgcagtacagattttgactgagatgctgacttggaattggcagtcaccggtttggctggtaacccctgtggtttatgagggttaccgtttgttgcagctgatgagaggattgaagcttggaactgaaatcattgcaccagcatggatgatgtatactattagaggactggtgtcctggtgggttctgattcttggtatgcagttgatgagggttgcttggtttgcaggcttcgctagtcgatatcgtcagcaaccgtcgcctcctggtgatacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

279

Amino Acids

30.86

Weight (kDa)

6.47

Isoelectric Point (pI)

42.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011176)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G60590 AT3G60590 AT3G60590 AT3G60590
fragaria_vesca FvH4_7g11080 FvH4_7g11080
malus_domestica MD07G1115500.v1.1
prunus_persica Prupe.2G138000_v2.0.a1
pyrus_communis pycom07g10900
rosa_chinensis RchiOBHm_Chr1g0349101
rosa_laevigata RLG00000028606
rosa_multiflora Rmu_sc0008324.1_g000003 Rmu_sc0012100.1_g000004
rosa_roxburghii Rroxscaffold_4G00306120
rosa_rugosa Rorug01G0200100
rosa_samantha Rh1AG217800 Rh1BG183300 Rh1CG202200 Rh1DG213100
rosa_wichuraiana Rw1G018510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 716
AclWI GGATC 4 cut(s) 8, 21, 480, 493
AcoI YGGCCR 1 cut(s) 191
AcuI CTGAAG 2 cut(s) 161, 369
AfaI GTAC 1 cut(s) 570
AfiI CCNNNNNNNGG 1 cut(s) 475
AgeI ACCGGT 1 cut(s) 610
AgsI TTSAA 4 cut(s) 67, 89, 506, 676
AjnI CCWGG 3 cut(s) 8, 737, 826
AluBI AGCT 5 cut(s) 142, 175, 420, 661, 679
AluI AGCT 5 cut(s) 142, 175, 420, 661, 679
AlwI GGATC 4 cut(s) 8, 21, 480, 493
AoxI GGCC 5 cut(s) 191, 208, 277, 374, 393
ApaI GGGCCC 1 cut(s) 212
ApeKI GCWGC 1 cut(s) 658
AsiGI ACCGGT 1 cut(s) 610
AspLEI GCGC 1 cut(s) 152
AspS9I GGNCC 5 cut(s) 181, 208, 209, 278, 545
AsuC2I CCSGG 1 cut(s) 373
AsuHPI GGTGA 1 cut(s) 600
AvaII GGWCC 2 cut(s) 181, 545
BaeGI GKGCMC 1 cut(s) 212
BalI TGGCCA 1 cut(s) 193
BamHI GGATCC 2 cut(s) 13, 485
BanII GRGCYC 1 cut(s) 212
BbvI GCAGC 1 cut(s) 670
BccI CCATC 2 cut(s) 469, 530
BciT130I CCWGG 3 cut(s) 10, 739, 828
BcnI CCSGG 1 cut(s) 373
BfaI CTAG 1 cut(s) 798
BglI GCCNNNNNGGC 1 cut(s) 199
BisI GCNGC 1 cut(s) 659
BlsI GCNGC 1 cut(s) 660
Bme1390I CCNGG 4 cut(s) 10, 373, 739, 828
Bme18I GGWCC 2 cut(s) 181, 545
BmgT120I GGNCC 5 cut(s) 181, 208, 209, 278, 545
BmiI GGNNCC 7 cut(s) 15, 169, 210, 280, 487, 546, 547
BmrFI CCNGG 4 cut(s) 10, 373, 739, 828
BmrI ACTGGG 1 cut(s) 505
BmsI GCATC 1 cut(s) 576
BmuI ACTGGG 1 cut(s) 505
BoxI GACNNNNGTC 1 cut(s) 733
BpuMI CCSGG 1 cut(s) 373
BsaJI CCNNGG 1 cut(s) 9
BsaWI WCCGGW 1 cut(s) 610
Bsc4I CCNNNNNNNGG 1 cut(s) 475
Bse118I RCCGGY 1 cut(s) 610
Bse1I ACTGG 6 cut(s) 51, 235, 396, 457, 511, 735
Bse3DI GCAATG 1 cut(s) 693
BseBI CCWGG 3 cut(s) 10, 739, 828
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 2 cut(s) 462, 714
BseLI CCNNNNNNNGG 1 cut(s) 475
BseMI GCAATG 1 cut(s) 693
BseMII CTCAG 1 cut(s) 573
BseNI ACTGG 6 cut(s) 51, 235, 396, 457, 511, 735
BseRI GAGGAG 3 cut(s) 212, 215, 341
BseSI GKGCMC 1 cut(s) 212
BseXI GCAGC 1 cut(s) 670
BshFI GGCC 5 cut(s) 193, 210, 279, 376, 395
BshTI ACCGGT 1 cut(s) 610
BsiSI CCGG 2 cut(s) 373, 611
BslFI GGGAC 1 cut(s) 531
BslI CCNNNNNNNGG 1 cut(s) 475
BsmFI GGGAC 1 cut(s) 531
BsnI GGCC 5 cut(s) 193, 210, 279, 376, 395
Bsp120I GGGCCC 1 cut(s) 208
Bsp1286I GDGCHC 1 cut(s) 212
Bsp143I GATC 2 cut(s) 13, 485
BspANI GGCC 5 cut(s) 193, 210, 279, 376, 395
BspCNI CTCAG 1 cut(s) 574
BspLI GGNNCC 7 cut(s) 15, 169, 210, 280, 487, 546, 547
BspPI GGATC 4 cut(s) 8, 21, 480, 493
BsrDI GCAATG 1 cut(s) 693
BsrFI RCCGGY 1 cut(s) 610
BsrI ACTGG 6 cut(s) 51, 235, 396, 457, 511, 735
BssAI RCCGGY 1 cut(s) 610
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 2 cut(s) 13, 485
BssNAI GTATAC 1 cut(s) 717
Bst1107I GTATAC 1 cut(s) 717
Bst2UI CCWGG 3 cut(s) 10, 739, 828
Bst4CI ACNGT 6 cut(s) 47, 134, 249, 448, 650, 819
BstC8I GCNNGC 3 cut(s) 292, 397, 790
BstDEI CTNAG 2 cut(s) 582, 837
BstEII GGTNACC 2 cut(s) 622, 644
BstF5I GGATG 2 cut(s) 462, 714
BstHHI GCGC 1 cut(s) 152
BstKTI GATC 2 cut(s) 16, 488
BstMBI GATC 2 cut(s) 13, 485
BstMWI GCNNNNNNNGC 5 cut(s) 110, 199, 785, 794, 820
BstNI CCWGG 3 cut(s) 10, 739, 828
BstNSI RCATGY 1 cut(s) 238
BstPAI GACNNNNGTC 1 cut(s) 733
BstPI GGTNACC 2 cut(s) 622, 644
BstSCI CCNGG 4 cut(s) 8, 371, 737, 826
BstSLI GKGCMC 1 cut(s) 212
BstV1I GCAGC 1 cut(s) 670
BstX2I RGATCY 2 cut(s) 13, 485
BstXI CCANNNNNNTGG 1 cut(s) 249
BstYI RGATCY 2 cut(s) 13, 485
BstZ17I GTATAC 1 cut(s) 717
BsuRI GGCC 5 cut(s) 193, 210, 279, 376, 395
BtsCI GGATG 2 cut(s) 462, 714
BtsI GCAGTG 1 cut(s) 108
BtsIMutI CAGTG 7 cut(s) 52, 58, 108, 139, 228, 245, 389
Cac8I GCNNGC 3 cut(s) 292, 397, 790
CfoI GCGC 1 cut(s) 152
Cfr10I RCCGGY 1 cut(s) 610
Cfr13I GGNCC 5 cut(s) 181, 208, 209, 278, 545
Csp6I GTAC 1 cut(s) 569
CspAI ACCGGT 1 cut(s) 610
CviAII CATG 3 cut(s) 235, 355, 705
CviQI GTAC 1 cut(s) 569
DdeI CTNAG 2 cut(s) 582, 837
DpnI GATC 2 cut(s) 15, 487
DpnII GATC 2 cut(s) 13, 485
EaeI YGGCCR 1 cut(s) 191
Eco24I GRGCYC 1 cut(s) 212
Eco32I GATATC 1 cut(s) 806
Eco47I GGWCC 2 cut(s) 181, 545
Eco57I CTGAAG 2 cut(s) 161, 369
Eco91I GGTNACC 2 cut(s) 622, 644
EcoO109I RGGNCCY 3 cut(s) 181, 209, 545
EcoO65I GGTNACC 2 cut(s) 622, 644
EcoRII CCWGG 3 cut(s) 8, 737, 826
EcoRV GATATC 1 cut(s) 806
EcoT38I GRGCYC 1 cut(s) 212
FaeI CATG 3 cut(s) 238, 358, 708
FaqI GGGAC 1 cut(s) 531
FatI CATG 3 cut(s) 234, 354, 704
FblI GTMKAC 1 cut(s) 716
Fnu4HI GCNGC 1 cut(s) 659
FokI GGATG 2 cut(s) 449, 721
FriOI GRGCYC 1 cut(s) 212
Fsp4HI GCNGC 1 cut(s) 659
FspBI CTAG 1 cut(s) 798
GlaI GCGC 1 cut(s) 151
GluI GCNGC 1 cut(s) 659
HaeIII GGCC 5 cut(s) 193, 210, 279, 376, 395
HapII CCGG 2 cut(s) 373, 611
HhaI GCGC 1 cut(s) 152
Hin1II CATG 3 cut(s) 238, 358, 708
Hin6I GCGC 1 cut(s) 150
HinP1I GCGC 1 cut(s) 150
HindIII AAGCTT 2 cut(s) 140, 677
HinfI GANTC 2 cut(s) 362, 751
HpaII CCGG 2 cut(s) 373, 611
HphI GGTGA 1 cut(s) 600
Hpy166II GTNNAC 1 cut(s) 717
Hpy188I TCNGA 4 cut(s) 25, 162, 311, 750
Hpy8I GTNNAC 1 cut(s) 717
Hpy99I CGWCG 1 cut(s) 823
HpyAV CCTTC 2 cut(s) 222, 512
HpyCH4III ACNGT 6 cut(s) 47, 134, 249, 448, 650, 819
HpyCH4V TGCA 9 cut(s) 321, 338, 399, 443, 533, 658, 698, 763, 788
HpyF10VI GCNNNNNNNGC 5 cut(s) 110, 199, 785, 794, 820
HpyF3I CTNAG 2 cut(s) 582, 837
Hsp92II CATG 3 cut(s) 238, 358, 708
HspAI GCGC 1 cut(s) 150
KflI GGGWCCC 1 cut(s) 545
Kzo9I GATC 2 cut(s) 13, 485
Lsp1109I GCAGC 1 cut(s) 670
LweI GCATC 1 cut(s) 576
MaeI CTAG 1 cut(s) 798
MaeIII GTNAC 4 cut(s) 448, 606, 622, 644
MalI GATC 2 cut(s) 15, 487
MboI GATC 2 cut(s) 13, 485
MboII GAAGA 2 cut(s) 255, 545
MflI RGATCY 2 cut(s) 13, 485
MhlI GDGCHC 1 cut(s) 212
MlsI TGGCCA 1 cut(s) 193
MluCI AATT 1 cut(s) 598
MluNI TGGCCA 1 cut(s) 193
MmeI TCCRAC 1 cut(s) 289
Mox20I TGGCCA 1 cut(s) 193
MscI TGGCCA 1 cut(s) 193
MseI TTAA 2 cut(s) 144, 327
MslI CAYNNNNRTG 2 cut(s) 233, 703
Msp20I TGGCCA 1 cut(s) 193
MspA1I CMGCKG 1 cut(s) 661
MspI CCGG 2 cut(s) 373, 611
MspR9I CCNGG 4 cut(s) 10, 373, 739, 828
MvaI CCWGG 3 cut(s) 10, 739, 828
MwoI GCNNNNNNNGC 5 cut(s) 110, 199, 785, 794, 820
NciI CCSGG 1 cut(s) 373
NdeII GATC 2 cut(s) 13, 485
NlaIII CATG 3 cut(s) 238, 358, 708
NlaIV GGNNCC 7 cut(s) 15, 169, 210, 280, 487, 546, 547
NmuCI GTSAC 2 cut(s) 448, 606
NspI RCATGY 1 cut(s) 238
PfeI GAWTC 2 cut(s) 362, 751
PinAI ACCGGT 1 cut(s) 610
PkrI GCNGC 1 cut(s) 660
PpuMI RGGWCCY 2 cut(s) 181, 545
PshAI GACNNNNGTC 1 cut(s) 733
Psp5II RGGWCCY 2 cut(s) 181, 545
Psp6I CCWGG 3 cut(s) 8, 737, 826
PspEI GGTNACC 2 cut(s) 622, 644
PspGI CCWGG 3 cut(s) 8, 737, 826
PspN4I GGNNCC 7 cut(s) 15, 169, 210, 280, 487, 546, 547
PspOMI GGGCCC 1 cut(s) 208
PspPI GGNCC 5 cut(s) 181, 208, 209, 278, 545
PspPPI RGGWCCY 2 cut(s) 181, 545
PsuI RGATCY 2 cut(s) 13, 485
PvuII CAGCTG 1 cut(s) 661
RsaI GTAC 1 cut(s) 570
RsaNI GTAC 1 cut(s) 569
RseI CAYNNNNRTG 2 cut(s) 233, 703
SaqAI TTAA 2 cut(s) 144, 327
SatI GCNGC 1 cut(s) 659
Sau3AI GATC 2 cut(s) 13, 485
Sau96I GGNCC 5 cut(s) 181, 208, 209, 278, 545
ScrFI CCNGG 4 cut(s) 10, 373, 739, 828
SduI GDGCHC 1 cut(s) 212
SetI ASST 7 cut(s) 144, 177, 183, 412, 422, 663, 681
SfaNI GCATC 1 cut(s) 576
SinI GGWCC 2 cut(s) 181, 545
SmiMI CAYNNNNRTG 2 cut(s) 233, 703
Sse9I AATT 1 cut(s) 598
SspMI CTAG 1 cut(s) 798
StyD4I CCNGG 4 cut(s) 8, 371, 737, 826
TaaI ACNGT 6 cut(s) 47, 134, 249, 448, 650, 819
TaqI TCGA 2 cut(s) 365, 802
TasI AATT 1 cut(s) 598
TatI WGTACW 1 cut(s) 568
TfiI GAWTC 2 cut(s) 362, 751
Tru1I TTAA 2 cut(s) 144, 327
Tru9I TTAA 2 cut(s) 144, 327
TscAI CASTG 7 cut(s) 52, 58, 115, 139, 235, 252, 396
TseFI GTSAC 2 cut(s) 448, 606
TseI GCWGC 1 cut(s) 658
Tsp45I GTSAC 2 cut(s) 448, 606
TspRI CASTG 7 cut(s) 52, 58, 115, 139, 235, 252, 396
VpaK11BI GGWCC 2 cut(s) 181, 545
XceI RCATGY 1 cut(s) 238
XmiI GTMKAC 1 cut(s) 716
XspI CTAG 1 cut(s) 798
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.