Rmu_sc0008864.1_g000017

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008864.1
Physical Location & Seq
Forward (+)
92241 .. 92534
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008864.1_g000017.1.cds

Sequence Viewer

Length: 294 bp
atgcgagaggtttccgagctgtttggagcttttaatatagccgatttctttccttggcttgggtggcttgacccacaaggtattaaacccagactcgttaagtctcgcaagtcactggacaagttcattgataagatcatagacgaccacatccaaaacagtaaaggtgaaggtgatgaaactgatattgttgatgatttactagccttcaacagagaccaagcaacagggaaggaatccgccatcttacttactagagataacatcaaagccattattctggtaatgaattaa

Protein Analysis

97

Amino Acids

11.03

Weight (kDa)

4.86

Isoelectric Point (pI)

24.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 240
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 211
AluBI AGCT 2 cut(s) 19, 29
AluI AGCT 2 cut(s) 19, 29
Alw26I GTCTC 2 cut(s) 108, 210
AsuHPI GGTGA 2 cut(s) 179, 185
BccI CCATC 1 cut(s) 251
BcoDI GTCTC 2 cut(s) 108, 210
BfaI CTAG 2 cut(s) 203, 255
BsaI GGTCTC 1 cut(s) 210
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse1I ACTGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 53
BseGI GGATG 1 cut(s) 150
BseLI CCNNNNNNNGG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 59
BsmAI GTCTC 2 cut(s) 108, 210
Bso31I GGTCTC 1 cut(s) 210
Bsp143I GATC 1 cut(s) 135
BspACI CCGC 1 cut(s) 240
BspTNI GGTCTC 1 cut(s) 210
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 1 cut(s) 135
BssT1I CCWWGG 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 161
BstF5I GGATG 1 cut(s) 150
BstKTI GATC 1 cut(s) 138
BstMAI GTCTC 2 cut(s) 108, 210
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstXI CCANNNNNNTGG 1 cut(s) 280
BtsCI GGATG 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 113
CviJI RGCY 7 cut(s) 19, 29, 41, 58, 67, 206, 272
CviKI_1 RGCY 7 cut(s) 19, 29, 41, 58, 67, 206, 272
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
EciI GGCGGA 1 cut(s) 229
Eco130I CCWWGG 1 cut(s) 53
Eco31I GGTCTC 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaiI YATR 2 cut(s) 38, 140
FokI GGATG 1 cut(s) 137
FspBI CTAG 2 cut(s) 203, 255
HinfI GANTC 2 cut(s) 93, 236
HphI GGTGA 2 cut(s) 179, 185
Hpy188I TCNGA 1 cut(s) 16
HpyAV CCTTC 3 cut(s) 164, 217, 226
HpyCH4III ACNGT 1 cut(s) 161
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
Kzo9I GATC 1 cut(s) 135
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 4 cut(s) 101, 103, 213, 266
MaeI CTAG 2 cut(s) 203, 255
MaeIII GTNAC 1 cut(s) 111
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MluCI AATT 1 cut(s) 289
MlyI GAGTC 1 cut(s) 87
MseI TTAA 4 cut(s) 33, 84, 99, 292
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 1 cut(s) 135
NmuCI GTSAC 1 cut(s) 111
PfeI GAWTC 1 cut(s) 236
PleI GAGTC 1 cut(s) 87
PpsI GAGTC 1 cut(s) 87
SaqAI TTAA 4 cut(s) 33, 84, 99, 292
Sau3AI GATC 1 cut(s) 135
SchI GAGTC 1 cut(s) 87
SetI ASST 6 cut(s) 12, 21, 31, 82, 169, 175
Sse9I AATT 1 cut(s) 289
SsiI CCGC 1 cut(s) 240
SspMI CTAG 2 cut(s) 203, 255
StyI CCWWGG 1 cut(s) 53
TaaI ACNGT 1 cut(s) 161
TasI AATT 1 cut(s) 289
TfiI GAWTC 1 cut(s) 236
Tru1I TTAA 4 cut(s) 33, 84, 99, 292
Tru9I TTAA 4 cut(s) 33, 84, 99, 292
TscAI CASTG 1 cut(s) 120
TseFI GTSAC 1 cut(s) 111
Tsp45I GTSAC 1 cut(s) 111
TspDTI ATGAA 2 cut(s) 115, 192
TspRI CASTG 1 cut(s) 120
XspI CTAG 2 cut(s) 203, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.