Rmu_sc0009001.1_g000016

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009001.1
Physical Location & Seq
Forward (+)
89555 .. 89910
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009001.1_g000016.1.cds

Sequence Viewer

Length: 264 bp
atgataagagaagtgcagctggttccgaaatcgacttcggatcgtcttctcgagaagttctttgatgctacacagtatgactttgattataatgagcagagtggattgtggtctccccctgtgcagcggagtgtgttcttgagttcacaaggtaaaatattcacagaacatgaaatgcatgccaagcttacaactttaatggctgctcaagctcgttctacaacacacaacaaaattcgttgccgagcattctggtgctcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.14

Weight (kDa)

8.71

Isoelectric Point (pI)

59.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014687)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 90
AciI CCGC 1 cut(s) 127
AclWI GGATC 1 cut(s) 48
AcsI RAATTY 1 cut(s) 234
AluBI AGCT 3 cut(s) 19, 187, 212
AluI AGCT 3 cut(s) 19, 187, 212
Alw21I GWGCWC 1 cut(s) 260
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 48
Ama87I CYCGRG 1 cut(s) 50
ApeKI GCWGC 3 cut(s) 16, 124, 203
ApoI RAATTY 1 cut(s) 234
AvaI CYCGRG 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 260
BbvI GCAGC 3 cut(s) 28, 136, 190
BcoDI GTCTC 1 cut(s) 117
BisI GCNGC 3 cut(s) 17, 125, 204
BlsI GCNGC 3 cut(s) 18, 126, 205
BmeT110I CYCGRG 1 cut(s) 50
BmiI GGNNCC 1 cut(s) 24
BmsI GCATC 1 cut(s) 55
BpiI GAAGAC 1 cut(s) 38
BpuEI CTTGAG 2 cut(s) 160, 192
BsaI GGTCTC 1 cut(s) 117
BseXI GCAGC 3 cut(s) 28, 136, 190
BsgI GTGCAG 2 cut(s) 35, 143
BsiHKAI GWGCWC 1 cut(s) 260
BsiHKCI CYCGRG 1 cut(s) 50
BsmAI GTCTC 1 cut(s) 117
BsmI GAATGC 1 cut(s) 248
Bso31I GGTCTC 1 cut(s) 117
BsoBI CYCGRG 1 cut(s) 50
Bsp1286I GDGCHC 1 cut(s) 260
Bsp143I GATC 1 cut(s) 40
BspACI CCGC 1 cut(s) 127
BspLI GGNNCC 1 cut(s) 24
BspPI GGATC 1 cut(s) 48
BspTNI GGTCTC 1 cut(s) 117
BssMI GATC 1 cut(s) 40
Bst4CI ACNGT 1 cut(s) 75
BstC8I GCNNGC 1 cut(s) 180
BstKTI GATC 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 2 cut(s) 184, 209
BstNSI RCATGY 1 cut(s) 182
BstV1I GCAGC 3 cut(s) 28, 136, 190
BstV2I GAAGAC 1 cut(s) 38
Cac8I GCNNGC 1 cut(s) 180
CviAII CATG 2 cut(s) 170, 179
CviJI RGCY 4 cut(s) 19, 187, 203, 212
CviKI_1 RGCY 4 cut(s) 19, 187, 203, 212
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco31I GGTCTC 1 cut(s) 117
Eco88I CYCGRG 1 cut(s) 50
EcoT22I ATGCAT 1 cut(s) 180
FaeI CATG 2 cut(s) 173, 182
FaiI YATR 4 cut(s) 78, 90, 171, 180
FatI CATG 2 cut(s) 169, 178
Fnu4HI GCNGC 3 cut(s) 17, 125, 204
Fsp4HI GCNGC 3 cut(s) 17, 125, 204
GluI GCNGC 3 cut(s) 17, 125, 204
Hin1II CATG 2 cut(s) 173, 182
HindIII AAGCTT 1 cut(s) 185
Hpy166II GTNNAC 1 cut(s) 146
Hpy188I TCNGA 2 cut(s) 27, 40
Hpy188III TCNNGA 4 cut(s) 50, 52, 139, 261
Hpy8I GTNNAC 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 75
HpyCH4V TGCA 3 cut(s) 16, 124, 178
HpyF10VI GCNNNNNNNGC 2 cut(s) 184, 209
Hsp92II CATG 2 cut(s) 173, 182
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 5, 132, 238
Lsp1109I GCAGC 3 cut(s) 28, 136, 190
LweI GCATC 1 cut(s) 55
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 1 cut(s) 38
MhlI GDGCHC 1 cut(s) 260
MluCI AATT 1 cut(s) 234
Mph1103I ATGCAT 1 cut(s) 180
MseI TTAA 1 cut(s) 197
MslI CAYNNNNRTG 1 cut(s) 253
MspA1I CMGCKG 2 cut(s) 19, 127
Mva1269I GAATGC 1 cut(s) 248
MwoI GCNNNNNNNGC 2 cut(s) 184, 209
NdeII GATC 1 cut(s) 40
NlaIII CATG 2 cut(s) 173, 182
NlaIV GGNNCC 1 cut(s) 24
NsiI ATGCAT 1 cut(s) 180
NspI RCATGY 1 cut(s) 182
PaeI GCATGC 1 cut(s) 182
PaeR7I CTCGAG 1 cut(s) 50
PctI GAATGC 1 cut(s) 248
PkrI GCNGC 3 cut(s) 18, 126, 205
PsiI TTATAA 1 cut(s) 90
PspN4I GGNNCC 1 cut(s) 24
PvuII CAGCTG 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 253
SaqAI TTAA 1 cut(s) 197
SatI GCNGC 3 cut(s) 17, 125, 204
Sau3AI GATC 1 cut(s) 40
SduI GDGCHC 1 cut(s) 260
SetI ASST 4 cut(s) 21, 154, 189, 214
SfaNI GCATC 1 cut(s) 55
Sfr274I CTCGAG 1 cut(s) 50
SlaI CTCGAG 1 cut(s) 50
SmiMI CAYNNNNRTG 1 cut(s) 253
SmlI CTYRAG 3 cut(s) 50, 139, 207
SmoI CTYRAG 3 cut(s) 50, 139, 207
SphI GCATGC 1 cut(s) 182
Sse9I AATT 1 cut(s) 234
SsiI CCGC 1 cut(s) 127
SspI AATATT 1 cut(s) 159
TaaI ACNGT 1 cut(s) 75
TaqI TCGA 2 cut(s) 32, 51
TasI AATT 1 cut(s) 234
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TseI GCWGC 3 cut(s) 16, 124, 203
TspDTI ATGAA 1 cut(s) 186
XapI RAATTY 1 cut(s) 234
XceI RCATGY 1 cut(s) 182
XhoI CTCGAG 1 cut(s) 50
Zsp2I ATGCAT 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.