Rmu_sc0009078.1_g000005

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009078.1
Physical Location & Seq
Forward (+)
18258 .. 19939
1682 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009078.1_g000005.1.cds

Sequence Viewer

Length: 981 bp
atgaagttctgcaagaaataccaggagtacatgcaaggccaagggaagaagctacctggggttggcttcaagaagcttaagaagatcttgaagaaatgccgcagagattttcagtccggaaatgacgttaataatcatgccgtacatgatcccagaacatgccctgaccattgcccagtgtgtgatgggtcgtttttcccttcactgctcaatgaaatgtctgcagtggtaggcttttttaaccagaaggcacagaaattgctcgagtaccatttggcttctgggtttcgcaagtacatgcttgtgttcaaaggcaagcctcgaggaaaccatgttgccttgatccaagaaggcaaggaccttgtcacttatgctctcattaacgccattgcgattcgaaaaatactcaagaaatatgataagattcattactcaaagcaagggcaggcctttaagtcacaagcgcaaagtatgcacattggaattcttcgaagtccttggctttgtgagcttatggctttccacatcaatttaaggcaatcgaagatcaagtcggggaagagaccggcgttgtttgagggatgctctcttacaatgaatgatgagaagccgtctctcacctgtgagctctttgattccgtcaaggttgatattgacttgacatgttctatatgcctggacacagtttttgatccagttgctctcacttgcggtcatatattctgctacctatgtgcttgctcggctgcatcagtgaccattgtcgatgggttaaaggctgctgagcctaaagaaaaatgccctttatgccgagaggcaaaagtttaccaaggttctgtacacctagaagagcttagcattttactcagcagaagctgccgcgaatactgggagcggcggattcagacagaaaaggtggagagggttcggcaagcaaagcagcactgggaatcacagtgccgggcattcatgggcgtttga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

326

Amino Acids

37.11

Weight (kDa)

9.24

Isoelectric Point (pI)

46.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 321
AccBSI CCGCTC 1 cut(s) 895
AccII CGCG 1 cut(s) 882
AccIII TCCGGA 1 cut(s) 116
AciI CCGC 5 cut(s) 100, 711, 880, 895, 898
AclWI GGATC 3 cut(s) 143, 337, 686
AcsI RAATTY 1 cut(s) 483
AfaI GTAC 5 cut(s) 29, 144, 269, 296, 840
AfiI CCNNNNNNNGG 1 cut(s) 62
AflII CTTAAG 1 cut(s) 77
AflIII ACRYGT 1 cut(s) 662
AgsI TTSAA 3 cut(s) 70, 91, 310
AjnI CCWGG 3 cut(s) 21, 55, 675
AluBI AGCT 6 cut(s) 52, 76, 511, 628, 853, 876
AluI AGCT 6 cut(s) 52, 76, 511, 628, 853, 876
Alw21I GWGCWC 1 cut(s) 630
Alw26I GTCTC 2 cut(s) 556, 618
AlwI GGATC 3 cut(s) 143, 337, 686
AlwNI CAGNNNCTG 1 cut(s) 876
Ama87I CYCGRG 2 cut(s) 263, 321
Aor13HI TCCGGA 1 cut(s) 116
AoxI GGCC 2 cut(s) 37, 447
ApeKI GCWGC 4 cut(s) 746, 779, 876, 940
ApoI RAATTY 1 cut(s) 483
ArsI GACNNNNNNTTYG 4 cut(s) 536, 568, 671, 703
AspLEI GCGC 1 cut(s) 466
AspS9I GGNCC 1 cut(s) 358
AsuC2I CCSGG 1 cut(s) 962
AsuHPI GGTGA 1 cut(s) 610
AsuII TTCGAA 2 cut(s) 397, 490
AvaI CYCGRG 2 cut(s) 263, 321
AvaII GGWCC 1 cut(s) 358
BanII GRGCYC 1 cut(s) 630
Bbv12I GWGCWC 1 cut(s) 630
BbvI GCAGC 4 cut(s) 733, 766, 863, 952
BccI CCATC 2 cut(s) 179, 761
BceAI ACGGC 2 cut(s) 125, 595
BciT130I CCWGG 3 cut(s) 23, 57, 677
BcnI CCSGG 1 cut(s) 962
BcoDI GTCTC 2 cut(s) 556, 618
BfaI CTAG 1 cut(s) 845
BfmI CTRYAG 1 cut(s) 222
BfrI CTTAAG 1 cut(s) 77
BglII AGATCT 1 cut(s) 84
BisI GCNGC 7 cut(s) 100, 747, 780, 877, 880, 896, 941
BlpI GCTNAGC 2 cut(s) 783, 854
BlsI GCNGC 7 cut(s) 101, 748, 781, 878, 881, 897, 942
Bme1390I CCNGG 4 cut(s) 23, 57, 677, 962
Bme18I GGWCC 1 cut(s) 358
BmeT110I CYCGRG 2 cut(s) 263, 321
BmgT120I GGNCC 1 cut(s) 358
BmrFI CCNGG 4 cut(s) 23, 57, 677, 962
BmrI ACTGGG 3 cut(s) 170, 898, 955
BmsI GCATC 2 cut(s) 572, 758
BmuI ACTGGG 3 cut(s) 170, 898, 955
BoxI GACNNNNGTC 1 cut(s) 761
BplI GAGNNNNNCTC 2 cut(s) 569, 601
Bpu1102I GCTNAGC 2 cut(s) 783, 854
Bpu14I TTCGAA 2 cut(s) 397, 490
BpuEI CTTGAG 1 cut(s) 392
BpuMI CCSGG 1 cut(s) 962
BsaI GGTCTC 1 cut(s) 556
BsaJI CCNNGG 4 cut(s) 40, 56, 497, 829
BsaWI WCCGGW 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse118I RCCGGY 1 cut(s) 565
Bse1I ACTGG 4 cut(s) 176, 695, 893, 950
Bse3DI GCAATG 2 cut(s) 169, 387
BseAI TCCGGA 1 cut(s) 116
BseBI CCWGG 3 cut(s) 23, 57, 677
BseDI CCNNGG 4 cut(s) 40, 56, 497, 829
BseGI GGATG 1 cut(s) 587
BseLI CCNNNNNNNGG 1 cut(s) 62
BseMI GCAATG 2 cut(s) 169, 387
BseMII CTCAG 2 cut(s) 774, 880
BseNI ACTGG 4 cut(s) 176, 695, 893, 950
BseXI GCAGC 4 cut(s) 733, 766, 863, 952
Bsh1236I CGCG 1 cut(s) 882
BshFI GGCC 2 cut(s) 39, 449
BsiHKAI GWGCWC 1 cut(s) 630
BsiHKCI CYCGRG 2 cut(s) 263, 321
BsiSI CCGG 3 cut(s) 117, 566, 961
BslI CCNNNNNNNGG 1 cut(s) 62
BsmAI GTCTC 2 cut(s) 556, 618
BsmBI CGTCTC 1 cut(s) 618
BsmI GAATGC 1 cut(s) 965
BsnI GGCC 2 cut(s) 39, 449
Bso31I GGTCTC 1 cut(s) 556
BsoBI CYCGRG 2 cut(s) 263, 321
Bsp119I TTCGAA 2 cut(s) 397, 490
Bsp1286I GDGCHC 1 cut(s) 630
Bsp13I TCCGGA 1 cut(s) 116
Bsp1407I TGTACA 1 cut(s) 838
Bsp143I GATC 5 cut(s) 84, 148, 342, 546, 691
Bsp1720I GCTNAGC 2 cut(s) 783, 854
BspACI CCGC 5 cut(s) 100, 711, 880, 895, 898
BspANI GGCC 2 cut(s) 39, 449
BspCNI CTCAG 2 cut(s) 775, 879
BspEI TCCGGA 1 cut(s) 116
BspFNI CGCG 1 cut(s) 882
BspMAI CTGCAG 1 cut(s) 226
BspPI GGATC 3 cut(s) 143, 337, 686
BspQI GCTCTTC 1 cut(s) 843
BspT104I TTCGAA 2 cut(s) 397, 490
BspTI CTTAAG 1 cut(s) 77
BspTNI GGTCTC 1 cut(s) 556
BsrBI CCGCTC 1 cut(s) 895
BsrDI GCAATG 2 cut(s) 169, 387
BsrFI RCCGGY 1 cut(s) 565
BsrGI TGTACA 1 cut(s) 838
BsrI ACTGG 4 cut(s) 176, 695, 893, 950
BssAI RCCGGY 1 cut(s) 565
BssECI CCNNGG 4 cut(s) 40, 56, 497, 829
BssMI GATC 5 cut(s) 84, 148, 342, 546, 691
BssT1I CCWWGG 3 cut(s) 40, 497, 829
Bst2UI CCWGG 3 cut(s) 23, 57, 677
Bst4CI ACNGT 2 cut(s) 685, 957
Bst6I CTCTTC 2 cut(s) 554, 843
BstAFI CTTAAG 1 cut(s) 77
BstAPI GCANNNNNTGC 2 cut(s) 472, 876
BstAUI TGTACA 1 cut(s) 838
BstBI TTCGAA 2 cut(s) 397, 490
BstC8I GCNNGC 4 cut(s) 317, 447, 739, 933
BstDEI CTNAG 3 cut(s) 783, 854, 866
BstF5I GGATG 1 cut(s) 587
BstFNI CGCG 1 cut(s) 882
BstHHI GCGC 1 cut(s) 466
BstKTI GATC 5 cut(s) 87, 151, 345, 549, 694
BstMAI GTCTC 2 cut(s) 556, 618
BstMBI GATC 5 cut(s) 84, 148, 342, 546, 691
BstMWI GCNNNNNNNGC 6 cut(s) 472, 508, 743, 807, 876, 937
BstNI CCWGG 3 cut(s) 23, 57, 677
BstNSI RCATGY 4 cut(s) 34, 162, 301, 666
BstPAI GACNNNNGTC 1 cut(s) 761
BstSCI CCNGG 4 cut(s) 21, 55, 675, 960
BstSFI CTRYAG 1 cut(s) 222
BstUI CGCG 1 cut(s) 882
BstV1I GCAGC 4 cut(s) 733, 766, 863, 952
BstX2I RGATCY 1 cut(s) 84
BstYI RGATCY 1 cut(s) 84
BsuRI GGCC 2 cut(s) 39, 449
BtsCI GGATG 1 cut(s) 587
BtsI GCAGTG 2 cut(s) 203, 231
BtsIMutI CAGTG 6 cut(s) 183, 203, 231, 759, 943, 962
Cac8I GCNNGC 4 cut(s) 317, 447, 739, 933
CaiI CAGNNNCTG 1 cut(s) 876
CfoI GCGC 1 cut(s) 466
Cfr10I RCCGGY 1 cut(s) 565
Cfr13I GGNCC 1 cut(s) 358
Csp6I GTAC 5 cut(s) 28, 143, 268, 295, 839
CviAII CATG 8 cut(s) 31, 137, 146, 159, 298, 332, 663, 970
CviQI GTAC 5 cut(s) 28, 143, 268, 295, 839
DdeI CTNAG 3 cut(s) 783, 854, 866
DpnI GATC 5 cut(s) 86, 150, 344, 548, 693
DpnII GATC 5 cut(s) 84, 148, 342, 546, 691
Eam1104I CTCTTC 2 cut(s) 554, 843
EarI CTCTTC 2 cut(s) 554, 843
EciI GGCGGA 1 cut(s) 913
Ecl136II GAGCTC 1 cut(s) 628
Eco130I CCWWGG 3 cut(s) 40, 497, 829
Eco147I AGGCCT 1 cut(s) 449
Eco24I GRGCYC 1 cut(s) 630
Eco31I GGTCTC 1 cut(s) 556
Eco47I GGWCC 1 cut(s) 358
Eco53kI GAGCTC 1 cut(s) 628
Eco88I CYCGRG 2 cut(s) 263, 321
EcoICRI GAGCTC 1 cut(s) 628
EcoO109I RGGNCCY 1 cut(s) 358
EcoRI GAATTC 1 cut(s) 483
EcoRII CCWGG 3 cut(s) 21, 55, 675
EcoT14I CCWWGG 3 cut(s) 40, 497, 829
EcoT38I GRGCYC 1 cut(s) 630
ErhI CCWWGG 3 cut(s) 40, 497, 829
Esp3I CGTCTC 1 cut(s) 618
FaeI CATG 8 cut(s) 34, 140, 149, 162, 301, 335, 666, 973
FalI AAGNNNNNCTT 2 cut(s) 71, 103
FatI CATG 8 cut(s) 30, 136, 145, 158, 297, 331, 662, 969
Fnu4HI GCNGC 7 cut(s) 100, 747, 780, 877, 880, 896, 941
FokI GGATG 1 cut(s) 594
FriOI GRGCYC 1 cut(s) 630
Fsp4HI GCNGC 7 cut(s) 100, 747, 780, 877, 880, 896, 941
FspBI CTAG 1 cut(s) 845
GlaI GCGC 1 cut(s) 465
GluI GCNGC 7 cut(s) 100, 747, 780, 877, 880, 896, 941
HaeIII GGCC 2 cut(s) 39, 449
HapII CCGG 3 cut(s) 117, 566, 961
HhaI GCGC 1 cut(s) 466
Hin1II CATG 8 cut(s) 34, 140, 149, 162, 301, 335, 666, 973
Hin6I GCGC 1 cut(s) 464
HinP1I GCGC 1 cut(s) 464
HindIII AAGCTT 1 cut(s) 74
HinfI GANTC 5 cut(s) 394, 424, 635, 901, 950
HpaII CCGG 3 cut(s) 117, 566, 961
HphI GGTGA 1 cut(s) 610
Hpy166II GTNNAC 2 cut(s) 826, 841
Hpy188I TCNGA 1 cut(s) 906
Hpy188III TCNNGA 4 cut(s) 70, 88, 117, 409
Hpy8I GTNNAC 2 cut(s) 826, 841
HpyAV CCTTC 3 cut(s) 210, 241, 344
HpyCH4III ACNGT 2 cut(s) 685, 957
HpyCH4IV ACGT 1 cut(s) 126
HpyCH4V TGCA 5 cut(s) 12, 34, 224, 475, 749
HpyF10VI GCNNNNNNNGC 6 cut(s) 472, 508, 743, 807, 876, 937
HpyF3I CTNAG 3 cut(s) 783, 854, 866
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 8 cut(s) 34, 140, 149, 162, 301, 335, 666, 973
HspAI GCGC 1 cut(s) 464
Kpn2I TCCGGA 1 cut(s) 116
Kzo9I GATC 5 cut(s) 84, 148, 342, 546, 691
LguI GCTCTTC 1 cut(s) 843
LmnI GCTCC 1 cut(s) 892
Lsp1109I GCAGC 4 cut(s) 733, 766, 863, 952
LweI GCATC 2 cut(s) 572, 758
MaeI CTAG 1 cut(s) 845
MaeII ACGT 1 cut(s) 126
MaeIII GTNAC 3 cut(s) 364, 456, 754
MalI GATC 5 cut(s) 86, 150, 344, 548, 693
MbiI CCGCTC 1 cut(s) 895
MboI GATC 5 cut(s) 84, 148, 342, 546, 691
MboII GAAGA 7 cut(s) 58, 94, 103, 479, 556, 571, 860
MflI RGATCY 1 cut(s) 84
MhlI GDGCHC 1 cut(s) 630
MluCI AATT 3 cut(s) 257, 483, 529
MnlI CCTC 5 cut(s) 317, 330, 571, 808, 915
MroI TCCGGA 1 cut(s) 116
MseI TTAA 7 cut(s) 78, 129, 240, 381, 453, 533, 773
MslI CAYNNNNRTG 1 cut(s) 302
MspCI CTTAAG 1 cut(s) 77
MspI CCGG 3 cut(s) 117, 566, 961
MspR9I CCNGG 4 cut(s) 23, 57, 677, 962
Mva1269I GAATGC 1 cut(s) 965
MvaI CCWGG 3 cut(s) 23, 57, 677
MvnI CGCG 1 cut(s) 882
MwoI GCNNNNNNNGC 6 cut(s) 472, 508, 743, 807, 876, 937
NciI CCSGG 1 cut(s) 962
NdeII GATC 5 cut(s) 84, 148, 342, 546, 691
NlaIII CATG 8 cut(s) 34, 140, 149, 162, 301, 335, 666, 973
NmeAIII GCCGAG 2 cut(s) 722, 836
NmuCI GTSAC 3 cut(s) 364, 456, 754
NspI RCATGY 4 cut(s) 34, 162, 301, 666
NspV TTCGAA 2 cut(s) 397, 490
PaeR7I CTCGAG 2 cut(s) 263, 321
PceI AGGCCT 1 cut(s) 449
PciI ACATGT 1 cut(s) 662
PciSI GCTCTTC 1 cut(s) 843
PctI GAATGC 1 cut(s) 965
PfeI GAWTC 5 cut(s) 394, 424, 635, 901, 950
PflFI GACNNNGTC 1 cut(s) 362
PkrI GCNGC 7 cut(s) 101, 748, 781, 878, 881, 897, 942
PpuMI RGGWCCY 1 cut(s) 358
PscI ACATGT 1 cut(s) 662
PshAI GACNNNNGTC 1 cut(s) 761
Psp124BI GAGCTC 1 cut(s) 630
Psp5II RGGWCCY 1 cut(s) 358
Psp6I CCWGG 3 cut(s) 21, 55, 675
PspGI CCWGG 3 cut(s) 21, 55, 675
PspPI GGNCC 1 cut(s) 358
PspPPI RGGWCCY 1 cut(s) 358
PspXI VCTCGAGB 2 cut(s) 263, 321
PstI CTGCAG 1 cut(s) 226
PstNI CAGNNNCTG 1 cut(s) 876
PsuI RGATCY 1 cut(s) 84
PsyI GACNNNGTC 1 cut(s) 362
RsaI GTAC 5 cut(s) 29, 144, 269, 296, 840
RsaNI GTAC 5 cut(s) 28, 143, 268, 295, 839
RseI CAYNNNNRTG 1 cut(s) 302
SacI GAGCTC 1 cut(s) 630
SapI GCTCTTC 1 cut(s) 843
SaqAI TTAA 7 cut(s) 78, 129, 240, 381, 453, 533, 773
SatI GCNGC 7 cut(s) 100, 747, 780, 877, 880, 896, 941
Sau3AI GATC 5 cut(s) 84, 148, 342, 546, 691
Sau96I GGNCC 1 cut(s) 358
ScrFI CCNGG 4 cut(s) 23, 57, 677, 962
SduI GDGCHC 1 cut(s) 630
SfaNI GCATC 2 cut(s) 572, 758
SfcI CTRYAG 1 cut(s) 222
Sfr274I CTCGAG 2 cut(s) 263, 321
SfuI TTCGAA 2 cut(s) 397, 490
SinI GGWCC 1 cut(s) 358
SlaI CTCGAG 2 cut(s) 263, 321
SmiMI CAYNNNNRTG 1 cut(s) 302
SmlI CTYRAG 4 cut(s) 77, 263, 321, 407
SmoI CTYRAG 4 cut(s) 77, 263, 321, 407
Sse9I AATT 3 cut(s) 257, 483, 529
SseBI AGGCCT 1 cut(s) 449
SsiI CCGC 5 cut(s) 100, 711, 880, 895, 898
SspMI CTAG 1 cut(s) 845
SstI GAGCTC 1 cut(s) 630
StuI AGGCCT 1 cut(s) 449
StyD4I CCNGG 4 cut(s) 21, 55, 675, 960
StyI CCWWGG 3 cut(s) 40, 497, 829
TaaI ACNGT 2 cut(s) 685, 957
TaiI ACGT 1 cut(s) 129
TaqI TCGA 6 cut(s) 264, 322, 397, 490, 542, 765
TasI AATT 3 cut(s) 257, 483, 529
TatI WGTACW 3 cut(s) 27, 294, 838
TauI GCSGC 3 cut(s) 102, 882, 898
TfiI GAWTC 5 cut(s) 394, 424, 635, 901, 950
Tru1I TTAA 7 cut(s) 78, 129, 240, 381, 453, 533, 773
Tru9I TTAA 7 cut(s) 78, 129, 240, 381, 453, 533, 773
TscAI CASTG 6 cut(s) 183, 210, 231, 759, 950, 962
TseFI GTSAC 3 cut(s) 364, 456, 754
TseI GCWGC 4 cut(s) 746, 779, 876, 940
Tsp45I GTSAC 3 cut(s) 364, 456, 754
TspDTI ATGAA 5 cut(s) 17, 228, 416, 611, 958
TspGWI ACGGA 1 cut(s) 628
TspRI CASTG 6 cut(s) 183, 210, 231, 759, 950, 962
Tth111I GACNNNGTC 1 cut(s) 362
Vha464I CTTAAG 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 358
XapI RAATTY 1 cut(s) 483
XceI RCATGY 4 cut(s) 34, 162, 301, 666
XcmI CCANNNNNNNNNTGG 1 cut(s) 278
XhoI CTCGAG 2 cut(s) 263, 321
XspI CTAG 1 cut(s) 845
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.