Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009084.1

Orthogroup ID

OG0011859

Physical Location & Seq

Genomic Coordinates Reverse (-)

41891 .. 44411

Gene Structure 2521 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009084.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 549 bp

atggggtcgatagcaaagcagtacttgattcagcttcagcgacatccattgagaacaaaggcactcacagctgggtttttgtcagcgatcagtgatatagcgtctcagaagctcacagggattcagaaacttcaattaagaaggcttgttctcaaagtgctttttggagttgcttatcttggaccatttgggcatttcctgcatttattactggacaaaattttcaaggggaagaaagataacaaaactgtaggcaagaaggtactagtggaacaattgacatcttctccttggaataacttgattttcatgctttactatgggctagttgtggagggaagaccatggatacatgtgaaaagtaaaattaagaaggactttccggcagtgcagtacacagcatggacgttttggcctgttctggggtggataaatcaccagtatgtaccactccaatttcgtgtcatcttccagagcttggttgggttttgctggggaatattcctaaatttacaagcaagatctgtggcattaccaaaggccaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005777 GO:0005778 GO:0005779 GO:0016020 GO:0016021 GO:0031090 GO:0031224 GO:0031231 GO:0031300 GO:0031301 GO:0031903 GO:0042579 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044438 GO:0044439 GO:0044444 GO:0044446 GO:0044464 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

ko04146 map04146

Pfam Domains

Protein Families

Mpv17_PMP22

Protein Analysis

182

Amino Acids

20.85

Weight (kDa)

10.37

Isoelectric Point (pI)

34.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011859)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G04470 AT4G04470
fragaria_vesca	FvH4_3g01800 FvH4_3g01800
malus_domestica	MD05G1349300.v1.1 MD10G1323900.v1.1
prunus_persica	Prupe.4G018300_v2.0.a1 Prupe.4G018300_v2.0.a1
pyrus_communis	pycom05g31690 pycom10g27430
rosa_chinensis	RchiOBHm_Chr5g0002631
rosa_laevigata	RLG00000031048
rosa_multiflora	Rmu_sc0009084.1_g000010
rosa_roxburghii	Rroxscaffold_1G00073230
rosa_rugosa	Rorug04G0397900
rosa_samantha	Rh5AG021300 Rh5CG023400 Rh5DG022400
rosa_wichuraiana	Rw5G001970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	478
AcsI	RAATTY	2 cut(s)	219, 508
AcuI	CTGAAG	1 cut(s)	20
AfaI	GTAC	4 cut(s)	23, 264, 395, 447
AfiI	CCNNNNNNNGG	2 cut(s)	422, 478
AflIII	ACRYGT	1 cut(s)	352
AgsI	TTSAA	2 cut(s)	134, 226
AhlI	ACTAGT	1 cut(s)	265
AluBI	AGCT	4 cut(s)	34, 71, 112, 477
AluI	AGCT	4 cut(s)	34, 71, 112, 477
Alw26I	GTCTC	1 cut(s)	108
AoxI	GGCC	2 cut(s)	413, 540
ApoI	RAATTY	2 cut(s)	219, 508
AspS9I	GGNCC	1 cut(s)	182
AsuHPI	GGTGA	1 cut(s)	428
AvaII	GGWCC	1 cut(s)	182
BbsI	GAAGAC	1 cut(s)	346
BciVI	GTATCC	1 cut(s)	342
BcoDI	GTCTC	1 cut(s)	108
BcuI	ACTAGT	1 cut(s)	265
BfaI	CTAG	2 cut(s)	266, 326
BfmI	CTRYAG	1 cut(s)	249
BfuI	GTATCC	1 cut(s)	342
BglII	AGATCT	1 cut(s)	521
BmcAI	AGTACT	1 cut(s)	23
Bme18I	GGWCC	1 cut(s)	182
BmgT120I	GGNCC	1 cut(s)	182
BpiI	GAAGAC	1 cut(s)	346
BsaJI	CCNNGG	2 cut(s)	290, 344
BsaXI	ACNNNNNCTCC	2 cut(s)	271, 301
Bsc4I	CCNNNNNNNGG	2 cut(s)	422, 478
Bse1I	ACTGG	2 cut(s)	216, 439
BseDI	CCNNGG	2 cut(s)	290, 344
BseGI	GGATG	1 cut(s)	43
BseLI	CCNNNNNNNGG	2 cut(s)	422, 478
BseMII	CTCAG	1 cut(s)	119
BseNI	ACTGG	2 cut(s)	216, 439
BseYI	CCCAGC	2 cut(s)	71, 492
BsgI	GTGCAG	1 cut(s)	410
BshFI	GGCC	2 cut(s)	415, 542
BsiSI	CCGG	1 cut(s)	383
BslI	CCNNNNNNNGG	2 cut(s)	422, 478
BsmAI	GTCTC	1 cut(s)	108
BsmBI	CGTCTC	1 cut(s)	108
BsnI	GGCC	2 cut(s)	415, 542
Bsp143I	GATC	2 cut(s)	87, 521
Bsp19I	CCATGG	1 cut(s)	344
BspANI	GGCC	2 cut(s)	415, 542
BspCNI	CTCAG	1 cut(s)	118
BsrI	ACTGG	2 cut(s)	216, 439
BssECI	CCNNGG	2 cut(s)	290, 344
BssMI	GATC	2 cut(s)	87, 521
BssT1I	CCWWGG	2 cut(s)	290, 344
Bst4CI	ACNGT	1 cut(s)	250
BstAPI	GCANNNNNTGC	1 cut(s)	199
BstDEI	CTNAG	1 cut(s)	105
BstDSI	CCRYGG	1 cut(s)	344
BstF5I	GGATG	1 cut(s)	43
BstKTI	GATC	2 cut(s)	90, 524
BstMAI	GTCTC	1 cut(s)	108
BstMBI	GATC	2 cut(s)	87, 521
BstMWI	GCNNNNNNNGC	2 cut(s)	68, 199
BstNSI	RCATGY	1 cut(s)	356
BstSFI	CTRYAG	1 cut(s)	249
BstV2I	GAAGAC	1 cut(s)	346
BstX2I	RGATCY	1 cut(s)	521
BstYI	RGATCY	1 cut(s)	521
BsuI	GTATCC	1 cut(s)	342
BsuRI	GGCC	2 cut(s)	415, 542
BtgI	CCRYGG	1 cut(s)	344
BtsCI	GGATG	1 cut(s)	43
BtsI	GCAGTG	1 cut(s)	393
BtsIMutI	CAGTG	2 cut(s)	97, 393
Cfr13I	GGNCC	1 cut(s)	182
CseI	GACGC	1 cut(s)	90
Csp6I	GTAC	4 cut(s)	22, 263, 394, 446
CspCI	CAANNNNNGTGG	2 cut(s)	507, 542
CviAII	CATG	4 cut(s)	310, 345, 353, 402
CviJI	RGCY	8 cut(s)	34, 71, 112, 145, 325, 415, 477, 542
CviKI_1	RGCY	8 cut(s)	34, 71, 112, 145, 325, 415, 477, 542
CviQI	GTAC	4 cut(s)	22, 263, 394, 446
DdeI	CTNAG	1 cut(s)	105
DpnI	GATC	2 cut(s)	89, 523
DpnII	GATC	2 cut(s)	87, 521
Eco130I	CCWWGG	2 cut(s)	290, 344
Eco47I	GGWCC	1 cut(s)	182
Eco57I	CTGAAG	1 cut(s)	20
EcoT14I	CCWWGG	2 cut(s)	290, 344
ErhI	CCWWGG	2 cut(s)	290, 344
Esp3I	CGTCTC	1 cut(s)	108
FaeI	CATG	4 cut(s)	313, 348, 356, 405
FaiI	YATR	7 cut(s)	98, 311, 321, 346, 354, 403, 444
FalI	AAGNNNNNCTT	4 cut(s)	8, 40, 362, 394
FatI	CATG	4 cut(s)	309, 344, 352, 401
FokI	GGATG	1 cut(s)	30
FspBI	CTAG	2 cut(s)	266, 326
GsaI	CCCAGC	2 cut(s)	75, 496
HaeIII	GGCC	2 cut(s)	415, 542
HapII	CCGG	1 cut(s)	383
HgaI	GACGC	1 cut(s)	90
Hin1II	CATG	4 cut(s)	313, 348, 356, 405
HinfI	GANTC	2 cut(s)	28, 121
HpaII	CCGG	1 cut(s)	383
HphI	GGTGA	1 cut(s)	428
Hpy166II	GTNNAC	1 cut(s)	396
Hpy188I	TCNGA	2 cut(s)	108, 126
Hpy188III	TCNNGA	1 cut(s)	472
Hpy8I	GTNNAC	1 cut(s)	396
HpyAV	CCTTC	3 cut(s)	135, 253, 367
HpyCH4III	ACNGT	1 cut(s)	250
HpyCH4IV	ACGT	1 cut(s)	407
HpyCH4V	TGCA	2 cut(s)	202, 391
HpyF10VI	GCNNNNNNNGC	2 cut(s)	68, 199
HpyF3I	CTNAG	1 cut(s)	105
HpySE526I	ACGT	1 cut(s)	407
Hsp92II	CATG	4 cut(s)	313, 348, 356, 405
Kzo9I	GATC	2 cut(s)	87, 521
MaeI	CTAG	2 cut(s)	266, 326
MaeII	ACGT	1 cut(s)	407
MalI	GATC	2 cut(s)	89, 523
MboI	GATC	2 cut(s)	87, 521
MboII	GAAGA	4 cut(s)	244, 276, 351, 460
MfeI	CAATTG	1 cut(s)	275
MflI	RGATCY	1 cut(s)	521
MluCI	AATT	6 cut(s)	134, 219, 275, 366, 455, 508
MnlI	CCTC	1 cut(s)	328
MseI	TTAA	2 cut(s)	137, 369
MslI	CAYNNNNRTG	1 cut(s)	441
MspA1I	CMGCKG	1 cut(s)	71
MspI	CCGG	1 cut(s)	383
MunI	CAATTG	1 cut(s)	275
MwoI	GCNNNNNNNGC	2 cut(s)	68, 199
NcoI	CCATGG	1 cut(s)	344
NdeII	GATC	2 cut(s)	87, 521
NlaIII	CATG	4 cut(s)	313, 348, 356, 405
NspI	RCATGY	1 cut(s)	356
PciI	ACATGT	1 cut(s)	352
PfeI	GAWTC	2 cut(s)	28, 121
PflMI	CCANNNNNTGG	1 cut(s)	478
PscI	ACATGT	1 cut(s)	352
PspFI	CCCAGC	2 cut(s)	71, 492
PspPI	GGNCC	1 cut(s)	182
PsuI	RGATCY	1 cut(s)	521
PvuII	CAGCTG	1 cut(s)	71
RsaI	GTAC	4 cut(s)	23, 264, 395, 447
RsaNI	GTAC	4 cut(s)	22, 263, 394, 446
RseI	CAYNNNNRTG	1 cut(s)	441
SaqAI	TTAA	2 cut(s)	137, 369
Sau3AI	GATC	2 cut(s)	87, 521
Sau96I	GGNCC	1 cut(s)	182
ScaI	AGTACT	1 cut(s)	23
SetI	ASST	6 cut(s)	36, 73, 114, 264, 410, 479
SfcI	CTRYAG	1 cut(s)	249
SinI	GGWCC	1 cut(s)	182
SmiMI	CAYNNNNRTG	1 cut(s)	441
SpeI	ACTAGT	1 cut(s)	265
Sse9I	AATT	6 cut(s)	134, 219, 275, 366, 455, 508
SspI	AATATT	1 cut(s)	501
SspMI	CTAG	2 cut(s)	266, 326
StyI	CCWWGG	2 cut(s)	290, 344
TaaI	ACNGT	1 cut(s)	250
TaiI	ACGT	1 cut(s)	410
TaqI	TCGA	1 cut(s)	8
TasI	AATT	6 cut(s)	134, 219, 275, 366, 455, 508
TatI	WGTACW	2 cut(s)	21, 393
TfiI	GAWTC	2 cut(s)	28, 121
Tru1I	TTAA	2 cut(s)	137, 369
Tru9I	TTAA	2 cut(s)	137, 369
TscAI	CASTG	2 cut(s)	97, 393
TspDTI	ATGAA	1 cut(s)	298
TspRI	CASTG	2 cut(s)	97, 393
Van91I	CCANNNNNTGG	1 cut(s)	478
VpaK11BI	GGWCC	1 cut(s)	182
XapI	RAATTY	2 cut(s)	219, 508
XceI	RCATGY	1 cut(s)	356
XcmI	CCANNNNNNNNNTGG	1 cut(s)	479
XspI	CTAG	2 cut(s)	266, 326
ZrmI	AGTACT	1 cut(s)	23

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.