Rmu_sc0009084.1_g000010

Belongs to the peroxisomal membrane protein PXMP2 4 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009084.1
Physical Location & Seq
Reverse (-)
41891 .. 44411
2521 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009084.1_g000010.1.cds

Sequence Viewer

Length: 549 bp
atggggtcgatagcaaagcagtacttgattcagcttcagcgacatccattgagaacaaaggcactcacagctgggtttttgtcagcgatcagtgatatagcgtctcagaagctcacagggattcagaaacttcaattaagaaggcttgttctcaaagtgctttttggagttgcttatcttggaccatttgggcatttcctgcatttattactggacaaaattttcaaggggaagaaagataacaaaactgtaggcaagaaggtactagtggaacaattgacatcttctccttggaataacttgattttcatgctttactatgggctagttgtggagggaagaccatggatacatgtgaaaagtaaaattaagaaggactttccggcagtgcagtacacagcatggacgttttggcctgttctggggtggataaatcaccagtatgtaccactccaatttcgtgtcatcttccagagcttggttgggttttgctggggaatattcctaaatttacaagcaagatctgtggcattaccaaaggccaagtga

Protein Analysis

182

Amino Acids

20.85

Weight (kDa)

10.37

Isoelectric Point (pI)

34.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011859)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 478
AcsI RAATTY 2 cut(s) 219, 508
AcuI CTGAAG 1 cut(s) 20
AfaI GTAC 4 cut(s) 23, 264, 395, 447
AfiI CCNNNNNNNGG 2 cut(s) 422, 478
AflIII ACRYGT 1 cut(s) 352
AgsI TTSAA 2 cut(s) 134, 226
AhlI ACTAGT 1 cut(s) 265
AluBI AGCT 4 cut(s) 34, 71, 112, 477
AluI AGCT 4 cut(s) 34, 71, 112, 477
Alw26I GTCTC 1 cut(s) 108
AoxI GGCC 2 cut(s) 413, 540
ApoI RAATTY 2 cut(s) 219, 508
AspS9I GGNCC 1 cut(s) 182
AsuHPI GGTGA 1 cut(s) 428
AvaII GGWCC 1 cut(s) 182
BbsI GAAGAC 1 cut(s) 346
BciVI GTATCC 1 cut(s) 342
BcoDI GTCTC 1 cut(s) 108
BcuI ACTAGT 1 cut(s) 265
BfaI CTAG 2 cut(s) 266, 326
BfmI CTRYAG 1 cut(s) 249
BfuI GTATCC 1 cut(s) 342
BglII AGATCT 1 cut(s) 521
BmcAI AGTACT 1 cut(s) 23
Bme18I GGWCC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 182
BpiI GAAGAC 1 cut(s) 346
BsaJI CCNNGG 2 cut(s) 290, 344
BsaXI ACNNNNNCTCC 2 cut(s) 271, 301
Bsc4I CCNNNNNNNGG 2 cut(s) 422, 478
Bse1I ACTGG 2 cut(s) 216, 439
BseDI CCNNGG 2 cut(s) 290, 344
BseGI GGATG 1 cut(s) 43
BseLI CCNNNNNNNGG 2 cut(s) 422, 478
BseMII CTCAG 1 cut(s) 119
BseNI ACTGG 2 cut(s) 216, 439
BseYI CCCAGC 2 cut(s) 71, 492
BsgI GTGCAG 1 cut(s) 410
BshFI GGCC 2 cut(s) 415, 542
BsiSI CCGG 1 cut(s) 383
BslI CCNNNNNNNGG 2 cut(s) 422, 478
BsmAI GTCTC 1 cut(s) 108
BsmBI CGTCTC 1 cut(s) 108
BsnI GGCC 2 cut(s) 415, 542
Bsp143I GATC 2 cut(s) 87, 521
Bsp19I CCATGG 1 cut(s) 344
BspANI GGCC 2 cut(s) 415, 542
BspCNI CTCAG 1 cut(s) 118
BsrI ACTGG 2 cut(s) 216, 439
BssECI CCNNGG 2 cut(s) 290, 344
BssMI GATC 2 cut(s) 87, 521
BssT1I CCWWGG 2 cut(s) 290, 344
Bst4CI ACNGT 1 cut(s) 250
BstAPI GCANNNNNTGC 1 cut(s) 199
BstDEI CTNAG 1 cut(s) 105
BstDSI CCRYGG 1 cut(s) 344
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 2 cut(s) 90, 524
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 2 cut(s) 87, 521
BstMWI GCNNNNNNNGC 2 cut(s) 68, 199
BstNSI RCATGY 1 cut(s) 356
BstSFI CTRYAG 1 cut(s) 249
BstV2I GAAGAC 1 cut(s) 346
BstX2I RGATCY 1 cut(s) 521
BstYI RGATCY 1 cut(s) 521
BsuI GTATCC 1 cut(s) 342
BsuRI GGCC 2 cut(s) 415, 542
BtgI CCRYGG 1 cut(s) 344
BtsCI GGATG 1 cut(s) 43
BtsI GCAGTG 1 cut(s) 393
BtsIMutI CAGTG 2 cut(s) 97, 393
Cfr13I GGNCC 1 cut(s) 182
CseI GACGC 1 cut(s) 90
Csp6I GTAC 4 cut(s) 22, 263, 394, 446
CspCI CAANNNNNGTGG 2 cut(s) 507, 542
CviAII CATG 4 cut(s) 310, 345, 353, 402
CviJI RGCY 8 cut(s) 34, 71, 112, 145, 325, 415, 477, 542
CviKI_1 RGCY 8 cut(s) 34, 71, 112, 145, 325, 415, 477, 542
CviQI GTAC 4 cut(s) 22, 263, 394, 446
DdeI CTNAG 1 cut(s) 105
DpnI GATC 2 cut(s) 89, 523
DpnII GATC 2 cut(s) 87, 521
Eco130I CCWWGG 2 cut(s) 290, 344
Eco47I GGWCC 1 cut(s) 182
Eco57I CTGAAG 1 cut(s) 20
EcoT14I CCWWGG 2 cut(s) 290, 344
ErhI CCWWGG 2 cut(s) 290, 344
Esp3I CGTCTC 1 cut(s) 108
FaeI CATG 4 cut(s) 313, 348, 356, 405
FaiI YATR 7 cut(s) 98, 311, 321, 346, 354, 403, 444
FalI AAGNNNNNCTT 4 cut(s) 8, 40, 362, 394
FatI CATG 4 cut(s) 309, 344, 352, 401
FokI GGATG 1 cut(s) 30
FspBI CTAG 2 cut(s) 266, 326
GsaI CCCAGC 2 cut(s) 75, 496
HaeIII GGCC 2 cut(s) 415, 542
HapII CCGG 1 cut(s) 383
HgaI GACGC 1 cut(s) 90
Hin1II CATG 4 cut(s) 313, 348, 356, 405
HinfI GANTC 2 cut(s) 28, 121
HpaII CCGG 1 cut(s) 383
HphI GGTGA 1 cut(s) 428
Hpy166II GTNNAC 1 cut(s) 396
Hpy188I TCNGA 2 cut(s) 108, 126
Hpy188III TCNNGA 1 cut(s) 472
Hpy8I GTNNAC 1 cut(s) 396
HpyAV CCTTC 3 cut(s) 135, 253, 367
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4IV ACGT 1 cut(s) 407
HpyCH4V TGCA 2 cut(s) 202, 391
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 199
HpyF3I CTNAG 1 cut(s) 105
HpySE526I ACGT 1 cut(s) 407
Hsp92II CATG 4 cut(s) 313, 348, 356, 405
Kzo9I GATC 2 cut(s) 87, 521
MaeI CTAG 2 cut(s) 266, 326
MaeII ACGT 1 cut(s) 407
MalI GATC 2 cut(s) 89, 523
MboI GATC 2 cut(s) 87, 521
MboII GAAGA 4 cut(s) 244, 276, 351, 460
MfeI CAATTG 1 cut(s) 275
MflI RGATCY 1 cut(s) 521
MluCI AATT 6 cut(s) 134, 219, 275, 366, 455, 508
MnlI CCTC 1 cut(s) 328
MseI TTAA 2 cut(s) 137, 369
MslI CAYNNNNRTG 1 cut(s) 441
MspA1I CMGCKG 1 cut(s) 71
MspI CCGG 1 cut(s) 383
MunI CAATTG 1 cut(s) 275
MwoI GCNNNNNNNGC 2 cut(s) 68, 199
NcoI CCATGG 1 cut(s) 344
NdeII GATC 2 cut(s) 87, 521
NlaIII CATG 4 cut(s) 313, 348, 356, 405
NspI RCATGY 1 cut(s) 356
PciI ACATGT 1 cut(s) 352
PfeI GAWTC 2 cut(s) 28, 121
PflMI CCANNNNNTGG 1 cut(s) 478
PscI ACATGT 1 cut(s) 352
PspFI CCCAGC 2 cut(s) 71, 492
PspPI GGNCC 1 cut(s) 182
PsuI RGATCY 1 cut(s) 521
PvuII CAGCTG 1 cut(s) 71
RsaI GTAC 4 cut(s) 23, 264, 395, 447
RsaNI GTAC 4 cut(s) 22, 263, 394, 446
RseI CAYNNNNRTG 1 cut(s) 441
SaqAI TTAA 2 cut(s) 137, 369
Sau3AI GATC 2 cut(s) 87, 521
Sau96I GGNCC 1 cut(s) 182
ScaI AGTACT 1 cut(s) 23
SetI ASST 6 cut(s) 36, 73, 114, 264, 410, 479
SfcI CTRYAG 1 cut(s) 249
SinI GGWCC 1 cut(s) 182
SmiMI CAYNNNNRTG 1 cut(s) 441
SpeI ACTAGT 1 cut(s) 265
Sse9I AATT 6 cut(s) 134, 219, 275, 366, 455, 508
SspI AATATT 1 cut(s) 501
SspMI CTAG 2 cut(s) 266, 326
StyI CCWWGG 2 cut(s) 290, 344
TaaI ACNGT 1 cut(s) 250
TaiI ACGT 1 cut(s) 410
TaqI TCGA 1 cut(s) 8
TasI AATT 6 cut(s) 134, 219, 275, 366, 455, 508
TatI WGTACW 2 cut(s) 21, 393
TfiI GAWTC 2 cut(s) 28, 121
Tru1I TTAA 2 cut(s) 137, 369
Tru9I TTAA 2 cut(s) 137, 369
TscAI CASTG 2 cut(s) 97, 393
TspDTI ATGAA 1 cut(s) 298
TspRI CASTG 2 cut(s) 97, 393
Van91I CCANNNNNTGG 1 cut(s) 478
VpaK11BI GGWCC 1 cut(s) 182
XapI RAATTY 2 cut(s) 219, 508
XceI RCATGY 1 cut(s) 356
XcmI CCANNNNNNNNNTGG 1 cut(s) 479
XspI CTAG 2 cut(s) 266, 326
ZrmI AGTACT 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.