Rmu_sc0009227.1_g000016

phosphatase 2C

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009227.1
Physical Location & Seq
Reverse (-)
58889 .. 59266
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009227.1_g000016.1.cds

Sequence Viewer

Length: 378 bp
atgctaaatttgattgcagtgcaaacaggggatcactaccttctgaatatttccatcacagaaagagagggaaatgaagatgaatgcttgattctagccaatcatggtatttgggatgctatatcagatgacatggcttgcagggtagctagaacatgtctcacatttgaagatggggaagctgctagagctcctgccaaagatggtcgtctttatggtccagacacatgtgatcatgagacgaacatgtttttctcttccaaaaccaacagtgcagctgcaatactctgccgcctcgctttgggccgtggcagtcgaggcgatataagtgtcattgttgtcgatttaatggttaggtcgaagtcaaggcaaaaatga
Functional Annotation

Protein Analysis

125

Amino Acids

13.7

Weight (kDa)

5.28

Isoelectric Point (pI)

39.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015576)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 292
AclWI GGATC 1 cut(s) 39
AcsI RAATTY 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 301
AflIII ACRYGT 3 cut(s) 155, 227, 246
AgsI TTSAA 1 cut(s) 170
AluBI AGCT 4 cut(s) 149, 182, 191, 278
AluI AGCT 4 cut(s) 149, 182, 191, 278
Alw21I GWGCWC 1 cut(s) 193
Alw26I GTCTC 2 cut(s) 164, 233
AlwI GGATC 1 cut(s) 39
AoxI GGCC 1 cut(s) 304
ApeKI GCWGC 3 cut(s) 182, 275, 278
ApoI RAATTY 1 cut(s) 7
AspS9I GGNCC 2 cut(s) 218, 304
AvaII GGWCC 1 cut(s) 218
BanII GRGCYC 1 cut(s) 193
Bbv12I GWGCWC 1 cut(s) 193
BbvI GCAGC 3 cut(s) 169, 265, 287
BccI CCATC 3 cut(s) 62, 167, 197
BceAI ACGGC 1 cut(s) 291
BclI TGATCA 1 cut(s) 232
BcoDI GTCTC 2 cut(s) 164, 233
BfaI CTAG 3 cut(s) 95, 150, 186
BisI GCNGC 4 cut(s) 183, 276, 279, 292
BlsI GCNGC 4 cut(s) 184, 277, 280, 293
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 2 cut(s) 218, 304
BmsI GCATC 1 cut(s) 106
BsaJI CCNNGG 1 cut(s) 307
Bsc4I CCNNNNNNNGG 1 cut(s) 301
BseDI CCNNGG 1 cut(s) 307
BseGI GGATG 1 cut(s) 121
BseLI CCNNNNNNNGG 1 cut(s) 301
BseXI GCAGC 3 cut(s) 169, 265, 287
BsgI GTGCAG 1 cut(s) 294
BshFI GGCC 1 cut(s) 306
BsiHKAI GWGCWC 1 cut(s) 193
BslI CCNNNNNNNGG 1 cut(s) 301
BsmAI GTCTC 2 cut(s) 164, 233
BsmBI CGTCTC 1 cut(s) 233
BsmI GAATGC 1 cut(s) 89
BsnI GGCC 1 cut(s) 306
Bsp1286I GDGCHC 1 cut(s) 193
Bsp143I GATC 2 cut(s) 31, 232
BspACI CCGC 1 cut(s) 292
BspANI GGCC 1 cut(s) 306
BspHI TCATGA 1 cut(s) 235
BspPI GGATC 1 cut(s) 39
BssECI CCNNGG 1 cut(s) 307
BssMI GATC 2 cut(s) 31, 232
Bst4CI ACNGT 1 cut(s) 272
Bst6I CTCTTC 1 cut(s) 262
BstC8I GCNNGC 1 cut(s) 139
BstDSI CCRYGG 1 cut(s) 307
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 2 cut(s) 34, 235
BstMAI GTCTC 2 cut(s) 164, 233
BstMBI GATC 2 cut(s) 31, 232
BstMWI GCNNNNNNNGC 2 cut(s) 188, 318
BstNSI RCATGY 3 cut(s) 159, 231, 250
BstV1I GCAGC 3 cut(s) 169, 265, 287
BsuRI GGCC 1 cut(s) 306
BtgI CCRYGG 1 cut(s) 307
BtsCI GGATG 1 cut(s) 121
BtsI GCAGTG 1 cut(s) 24
BtsIMutI CAGTG 2 cut(s) 24, 277
Cac8I GCNNGC 1 cut(s) 139
CciI TCATGA 1 cut(s) 235
Cfr13I GGNCC 2 cut(s) 218, 304
CviAII CATG 6 cut(s) 104, 133, 156, 228, 236, 247
CviJI RGCY 7 cut(s) 98, 137, 149, 182, 191, 278, 306
CviKI_1 RGCY 7 cut(s) 98, 137, 149, 182, 191, 278, 306
DpnI GATC 2 cut(s) 33, 234
DpnII GATC 2 cut(s) 31, 232
Eam1104I CTCTTC 1 cut(s) 262
EarI CTCTTC 1 cut(s) 262
Ecl136II GAGCTC 1 cut(s) 191
Eco24I GRGCYC 1 cut(s) 193
Eco47I GGWCC 1 cut(s) 218
Eco53kI GAGCTC 1 cut(s) 191
EcoICRI GAGCTC 1 cut(s) 191
EcoT38I GRGCYC 1 cut(s) 193
Esp3I CGTCTC 1 cut(s) 233
FaeI CATG 6 cut(s) 107, 136, 159, 231, 239, 250
FaiI YATR 9 cut(s) 105, 122, 134, 157, 216, 229, 237, 248, 326
FatI CATG 6 cut(s) 103, 132, 155, 227, 235, 246
FbaI TGATCA 1 cut(s) 232
Fnu4HI GCNGC 4 cut(s) 183, 276, 279, 292
FokI GGATG 1 cut(s) 128
FriOI GRGCYC 1 cut(s) 193
Fsp4HI GCNGC 4 cut(s) 183, 276, 279, 292
FspBI CTAG 3 cut(s) 95, 150, 186
GluI GCNGC 4 cut(s) 183, 276, 279, 292
HaeIII GGCC 1 cut(s) 306
Hin1II CATG 6 cut(s) 107, 136, 159, 231, 239, 250
HinfI GANTC 1 cut(s) 91
Hpy188I TCNGA 2 cut(s) 45, 127
Hpy188III TCNNGA 2 cut(s) 221, 236
HpyAV CCTTC 1 cut(s) 50
HpyCH4III ACNGT 1 cut(s) 272
HpyCH4V TGCA 5 cut(s) 17, 22, 141, 275, 281
HpyF10VI GCNNNNNNNGC 2 cut(s) 188, 318
Hsp92II CATG 6 cut(s) 107, 136, 159, 231, 239, 250
Ksp22I TGATCA 1 cut(s) 232
Kzo9I GATC 2 cut(s) 31, 232
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 4 cut(s) 12, 127, 207, 234
Lsp1109I GCAGC 3 cut(s) 169, 265, 287
LweI GCATC 1 cut(s) 106
MaeI CTAG 3 cut(s) 95, 150, 186
MalI GATC 2 cut(s) 33, 234
MboI GATC 2 cut(s) 31, 232
MboII GAAGA 3 cut(s) 89, 182, 249
MhlI GDGCHC 1 cut(s) 193
MluCI AATT 1 cut(s) 7
MnlI CCTC 3 cut(s) 61, 305, 311
MseI TTAA 1 cut(s) 347
MspA1I CMGCKG 1 cut(s) 278
Mva1269I GAATGC 1 cut(s) 89
MwoI GCNNNNNNNGC 2 cut(s) 188, 318
NdeII GATC 2 cut(s) 31, 232
NlaIII CATG 6 cut(s) 107, 136, 159, 231, 239, 250
NspI RCATGY 3 cut(s) 159, 231, 250
PagI TCATGA 1 cut(s) 235
PciI ACATGT 3 cut(s) 155, 227, 246
PctI GAATGC 1 cut(s) 89
PfeI GAWTC 1 cut(s) 91
PkrI GCNGC 4 cut(s) 184, 277, 280, 293
PscI ACATGT 3 cut(s) 155, 227, 246
Psp124BI GAGCTC 1 cut(s) 193
PspPI GGNCC 2 cut(s) 218, 304
PvuII CAGCTG 1 cut(s) 278
SacI GAGCTC 1 cut(s) 193
SaqAI TTAA 1 cut(s) 347
SatI GCNGC 4 cut(s) 183, 276, 279, 292
Sau3AI GATC 2 cut(s) 31, 232
Sau96I GGNCC 2 cut(s) 218, 304
SduI GDGCHC 1 cut(s) 193
SetI ASST 6 cut(s) 42, 151, 184, 193, 280, 359
SfaNI GCATC 1 cut(s) 106
SinI GGWCC 1 cut(s) 218
Sse9I AATT 1 cut(s) 7
SsiI CCGC 1 cut(s) 292
SspI AATATT 1 cut(s) 49
SspMI CTAG 3 cut(s) 95, 150, 186
SstI GAGCTC 1 cut(s) 193
TaaI ACNGT 1 cut(s) 272
TaqI TCGA 3 cut(s) 316, 342, 359
TasI AATT 1 cut(s) 7
TauI GCSGC 1 cut(s) 294
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 347
Tru9I TTAA 1 cut(s) 347
TscAI CASTG 2 cut(s) 24, 277
TseI GCWGC 3 cut(s) 182, 275, 278
TspDTI ATGAA 2 cut(s) 90, 96
TspRI CASTG 2 cut(s) 24, 277
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 1 cut(s) 7
XceI RCATGY 3 cut(s) 159, 231, 250
XspI CTAG 3 cut(s) 95, 150, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.