Rmu_sc0009586.1_g000003

Phosphate-induced protein 1 conserved region

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009586.1
Physical Location & Seq
Reverse (-)
13150 .. 14169
1020 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009586.1_g000003.1.cds

Sequence Viewer

Length: 1020 bp
atgatgcaaaatctgcattgcaatttcttcttcttgctttcctgcatttttttctctactactttggctcttccatggagccaaagcagacagttcaaccaagccaaaaactatgagggctcttctgattttgtggaccttcagtaccacatgggtcctgtccttgcttcttctccaatcaacgtttacattatttggtatgggaattggaacccaactcaccaatccaccattagagatttcatctactcactctcttcaccagccccttacccttctgtttctgattggtggaagactgtgaggctctacactgatcaaactggctcaaacatcactgggactatttctctttctggtgagttctatgactctaagtactcccatggcggttctcttagccgattgtcaatgcaatccatcatcaagcatgctgtcacttcatcatatccgagagcattacctctcaatccaaacaatggtctctacttagttctaacatcttctgatgttaaagttcaagatttctgtagagcagtgtgtggttttcactacttcacatttccaaccattgttggtgtcactatgccttatgcttgggttggttacagtgggaagcaatgtcctggcatctgcgcatacccatttgcatggcccaagtactcaggcaggccaccacctaacacaaatggaggtaacaacataatgaaagcaccgaatggcgatccgggtgttgatgggatgatcagtgtgctagctcatgagctagcagaagtgtcaagcaacccacttgtgaatgcttggtatgcaggtgatgacccaactgcaccaactgaaatagcagatttgtgtatgggggtttatgggagtggtgggggtggtgggtatgttggggtagtgtctaaggacagatggggaaatgggtataatgtgaatggggtgaaaggtagaaagttcatggtgcaatgggtgtggaaccctgtgaaaagaagatgctttggtcccaatgctatggattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

339

Amino Acids

37.42

Weight (kDa)

8.33

Isoelectric Point (pI)

37.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016520)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G35150
fragaria_vesca FvH4_3g12280
malus_domestica MD10G1232600.v1.1
prunus_persica Prupe.4G111900_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0020091
rosa_laevigata RLG00000032498
rosa_multiflora Rmu_sc0009586.1_g000003
rosa_roxburghii Rroxscaffold_1G00058110
rosa_rugosa Rorug05G0056800
rosa_samantha Rh5AG147000 Rh5BG146400 Rh5CG158100 Rh5DG146000
rosa_wichuraiana Rw5G012990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 800
Acc16I TGCGCA 1 cut(s) 637
Acc36I ACCTGC 1 cut(s) 800
AccB7I CCANNNNNTGG 1 cut(s) 479
AciI CCGC 1 cut(s) 390
AclI AACGTT 1 cut(s) 183
AclWI GGATC 1 cut(s) 719
AcuI CTGAAG 1 cut(s) 125
AfaI GTAC 3 cut(s) 146, 380, 662
AfiI CCNNNNNNNGG 1 cut(s) 479
AgsI TTSAA 2 cut(s) 97, 521
AjnI CCWGG 1 cut(s) 625
AluBI AGCT 2 cut(s) 758, 766
AluI AGCT 2 cut(s) 758, 766
Alw26I GTCTC 1 cut(s) 488
AlwI GGATC 1 cut(s) 719
AoxI GGCC 2 cut(s) 653, 671
AspLEI GCGC 1 cut(s) 638
AspS9I GGNCC 4 cut(s) 136, 155, 654, 1001
AsuC2I CCSGG 1 cut(s) 729
AsuHPI GGTGA 5 cut(s) 212, 252, 371, 824, 952
AsuNHI GCTAGC 2 cut(s) 754, 766
AvaII GGWCC 3 cut(s) 136, 155, 1001
BanII GRGCYC 1 cut(s) 122
BbsI GAAGAC 1 cut(s) 302
BccI CCATC 3 cut(s) 428, 731, 906
BciT130I CCWGG 1 cut(s) 627
BclI TGATCA 2 cut(s) 316, 744
BcnI CCSGG 1 cut(s) 729
BcoDI GTCTC 1 cut(s) 488
BfaI CTAG 2 cut(s) 755, 767
BfmI CTRYAG 1 cut(s) 529
BfuAI ACCTGC 1 cut(s) 800
BmcAI AGTACT 2 cut(s) 380, 662
Bme1390I CCNGG 2 cut(s) 627, 729
Bme18I GGWCC 3 cut(s) 136, 155, 1001
BmgT120I GGNCC 4 cut(s) 136, 155, 654, 1001
BmiI GGNNCC 5 cut(s) 80, 156, 212, 977, 1003
BmrFI CCNGG 2 cut(s) 627, 729
BmrI ACTGGG 1 cut(s) 348
BmsI GCATC 2 cut(s) 639, 983
BmtI GCTAGC 2 cut(s) 758, 770
BmuI ACTGGG 1 cut(s) 348
BpiI GAAGAC 1 cut(s) 302
BpuMI CCSGG 1 cut(s) 729
BsaI GGTCTC 1 cut(s) 488
BsaJI CCNNGG 2 cut(s) 74, 385
Bsc4I CCNNNNNNNGG 1 cut(s) 479
Bse1I ACTGG 2 cut(s) 328, 343
Bse3DI GCAATG 3 cut(s) 16, 626, 971
BseBI CCWGG 1 cut(s) 627
BseDI CCNNGG 2 cut(s) 74, 385
BseGI GGATG 1 cut(s) 747
BseLI CCNNNNNNNGG 1 cut(s) 479
BseMI GCAATG 3 cut(s) 16, 626, 971
BseMII CTCAG 1 cut(s) 678
BseNI ACTGG 2 cut(s) 328, 343
BsgI GTGCAG 1 cut(s) 810
BshFI GGCC 2 cut(s) 655, 673
BsiSI CCGG 1 cut(s) 728
BslFI GGGAC 2 cut(s) 355, 987
BslI CCNNNNNNNGG 1 cut(s) 479
BsmAI GTCTC 1 cut(s) 488
BsmFI GGGAC 2 cut(s) 355, 987
BsmI GAATGC 1 cut(s) 802
BsnI GGCC 2 cut(s) 655, 673
Bso31I GGTCTC 1 cut(s) 488
Bsp1286I GDGCHC 1 cut(s) 122
Bsp143I GATC 3 cut(s) 316, 724, 744
Bsp19I CCATGG 2 cut(s) 74, 385
BspACI CCGC 1 cut(s) 390
BspANI GGCC 2 cut(s) 655, 673
BspCNI CTCAG 1 cut(s) 677
BspHI TCATGA 1 cut(s) 760
BspLI GGNNCC 5 cut(s) 80, 156, 212, 977, 1003
BspMI ACCTGC 1 cut(s) 800
BspOI GCTAGC 2 cut(s) 758, 770
BspPI GGATC 1 cut(s) 719
BspQI GCTCTTC 2 cut(s) 75, 127
BspTNI GGTCTC 1 cut(s) 488
BsrDI GCAATG 3 cut(s) 16, 626, 971
BsrI ACTGG 2 cut(s) 328, 343
BssECI CCNNGG 2 cut(s) 74, 385
BssMI GATC 3 cut(s) 316, 724, 744
BssT1I CCWWGG 2 cut(s) 74, 385
Bst2UI CCWGG 1 cut(s) 627
Bst4CI ACNGT 3 cut(s) 93, 301, 611
Bst6I CTCTTC 3 cut(s) 75, 127, 262
BstAPI GCANNNNNTGC 1 cut(s) 13
BstC8I GCNNGC 4 cut(s) 432, 671, 756, 768
BstDEI CTNAG 5 cut(s) 375, 398, 490, 664, 903
BstDSI CCRYGG 2 cut(s) 74, 385
BstF5I GGATG 1 cut(s) 747
BstHHI GCGC 1 cut(s) 638
BstKTI GATC 3 cut(s) 319, 727, 747
BstMAI GTCTC 1 cut(s) 488
BstMBI GATC 3 cut(s) 316, 724, 744
BstMWI GCNNNNNNNGC 2 cut(s) 13, 806
BstNI CCWGG 1 cut(s) 627
BstNSI RCATGY 1 cut(s) 434
BstSCI CCNGG 2 cut(s) 625, 727
BstSFI CTRYAG 1 cut(s) 529
BstV2I GAAGAC 1 cut(s) 302
BstXI CCANNNNNNTGG 2 cut(s) 651, 1012
BsuRI GGCC 2 cut(s) 655, 673
BtgI CCRYGG 2 cut(s) 74, 385
BtsCI GGATG 1 cut(s) 747
BtsI GCAGTG 1 cut(s) 543
BtsIMutI CAGTG 5 cut(s) 312, 336, 543, 616, 754
BveI ACCTGC 1 cut(s) 800
Cac8I GCNNGC 4 cut(s) 432, 671, 756, 768
CciI TCATGA 1 cut(s) 760
CfoI GCGC 1 cut(s) 638
Cfr13I GGNCC 4 cut(s) 136, 155, 654, 1001
Csp6I GTAC 3 cut(s) 145, 379, 661
CspCI CAANNNNNGTGG 2 cut(s) 953, 988
CviAII CATG 7 cut(s) 75, 151, 386, 431, 651, 761, 958
CviQI GTAC 3 cut(s) 145, 379, 661
DdeI CTNAG 5 cut(s) 375, 398, 490, 664, 903
DpnI GATC 3 cut(s) 318, 726, 746
DpnII GATC 3 cut(s) 316, 724, 744
Eam1104I CTCTTC 3 cut(s) 75, 127, 262
EarI CTCTTC 3 cut(s) 75, 127, 262
Eco130I CCWWGG 2 cut(s) 74, 385
Eco24I GRGCYC 1 cut(s) 122
Eco31I GGTCTC 1 cut(s) 488
Eco47I GGWCC 3 cut(s) 136, 155, 1001
Eco57I CTGAAG 1 cut(s) 125
EcoO109I RGGNCCY 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 625
EcoT14I CCWWGG 2 cut(s) 74, 385
EcoT38I GRGCYC 1 cut(s) 122
ErhI CCWWGG 2 cut(s) 74, 385
FaeI CATG 7 cut(s) 78, 154, 389, 434, 654, 764, 961
FaqI GGGAC 2 cut(s) 355, 987
FatI CATG 7 cut(s) 74, 150, 385, 430, 650, 760, 957
FbaI TGATCA 2 cut(s) 316, 744
FokI GGATG 1 cut(s) 754
FriOI GRGCYC 1 cut(s) 122
FspBI CTAG 2 cut(s) 755, 767
FspI TGCGCA 1 cut(s) 637
GlaI GCGC 1 cut(s) 637
HaeIII GGCC 2 cut(s) 655, 673
HapII CCGG 1 cut(s) 728
HhaI GCGC 1 cut(s) 638
Hin1II CATG 7 cut(s) 78, 154, 389, 434, 654, 764, 961
Hin6I GCGC 1 cut(s) 636
HinP1I GCGC 1 cut(s) 636
HinfI GANTC 1 cut(s) 371
HpaII CCGG 1 cut(s) 728
HphI GGTGA 5 cut(s) 212, 252, 371, 824, 952
Hpy166II GTNNAC 2 cut(s) 136, 187
Hpy188I TCNGA 4 cut(s) 127, 286, 453, 508
Hpy188III TCNNGA 2 cut(s) 521, 761
Hpy8I GTNNAC 2 cut(s) 136, 187
HpyAV CCTTC 2 cut(s) 149, 285
HpyCH4III ACNGT 3 cut(s) 93, 301, 611
HpyCH4IV ACGT 1 cut(s) 183
HpyCH4V TGCA 9 cut(s) 7, 16, 21, 45, 415, 650, 809, 827, 964
HpyF10VI GCNNNNNNNGC 2 cut(s) 13, 806
HpyF3I CTNAG 5 cut(s) 375, 398, 490, 664, 903
HpySE526I ACGT 1 cut(s) 183
Hsp92II CATG 7 cut(s) 78, 154, 389, 434, 654, 764, 961
HspAI GCGC 1 cut(s) 636
Ksp22I TGATCA 2 cut(s) 316, 744
Kzo9I GATC 3 cut(s) 316, 724, 744
LguI GCTCTTC 2 cut(s) 75, 127
LmnI GCTCC 1 cut(s) 78
LweI GCATC 2 cut(s) 639, 983
MaeI CTAG 2 cut(s) 755, 767
MaeII ACGT 1 cut(s) 183
MaeIII GTNAC 4 cut(s) 436, 580, 605, 695
MalI GATC 3 cut(s) 318, 726, 746
MboI GATC 3 cut(s) 316, 724, 744
MboII GAAGA 9 cut(s) 19, 22, 62, 114, 162, 249, 307, 495, 1002
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 2 cut(s) 22, 205
MlyI GAGTC 1 cut(s) 365
MmeI TCCRAC 1 cut(s) 590
MnlI CCTC 4 cut(s) 109, 297, 474, 686
MseI TTAA 1 cut(s) 513
MslI CAYNNNNRTG 1 cut(s) 649
MspI CCGG 1 cut(s) 728
MspR9I CCNGG 2 cut(s) 627, 729
Mva1269I GAATGC 1 cut(s) 802
MvaI CCWGG 1 cut(s) 627
MwoI GCNNNNNNNGC 2 cut(s) 13, 806
NciI CCSGG 1 cut(s) 729
NcoI CCATGG 2 cut(s) 74, 385
NdeII GATC 3 cut(s) 316, 724, 744
NheI GCTAGC 2 cut(s) 754, 766
NlaIII CATG 7 cut(s) 78, 154, 389, 434, 654, 764, 961
NlaIV GGNNCC 5 cut(s) 80, 156, 212, 977, 1003
NmuCI GTSAC 2 cut(s) 436, 580
NsbI TGCGCA 1 cut(s) 637
NspI RCATGY 1 cut(s) 434
PaeI GCATGC 1 cut(s) 434
PagI TCATGA 1 cut(s) 760
PaqCI CACCTGC 1 cut(s) 800
PciSI GCTCTTC 2 cut(s) 75, 127
PctI GAATGC 1 cut(s) 802
PflMI CCANNNNNTGG 1 cut(s) 479
PleI GAGTC 1 cut(s) 365
PpsI GAGTC 1 cut(s) 365
PpuMI RGGWCCY 1 cut(s) 155
Psp1406I AACGTT 1 cut(s) 183
Psp5II RGGWCCY 1 cut(s) 155
Psp6I CCWGG 1 cut(s) 625
PspGI CCWGG 1 cut(s) 625
PspN4I GGNNCC 5 cut(s) 80, 156, 212, 977, 1003
PspPI GGNCC 4 cut(s) 136, 155, 654, 1001
PspPPI RGGWCCY 1 cut(s) 155
RsaI GTAC 3 cut(s) 146, 380, 662
RsaNI GTAC 3 cut(s) 145, 379, 661
RseI CAYNNNNRTG 1 cut(s) 649
SapI GCTCTTC 2 cut(s) 75, 127
SaqAI TTAA 1 cut(s) 513
Sau3AI GATC 3 cut(s) 316, 724, 744
Sau96I GGNCC 4 cut(s) 136, 155, 654, 1001
ScaI AGTACT 2 cut(s) 380, 662
SchI GAGTC 1 cut(s) 365
ScrFI CCNGG 2 cut(s) 627, 729
SduI GDGCHC 1 cut(s) 122
SetI ASST 9 cut(s) 141, 186, 466, 682, 697, 760, 768, 814, 949
SfaNI GCATC 2 cut(s) 639, 983
SfcI CTRYAG 1 cut(s) 529
SinI GGWCC 3 cut(s) 136, 155, 1001
SmiMI CAYNNNNRTG 1 cut(s) 649
SphI GCATGC 1 cut(s) 434
Sse9I AATT 2 cut(s) 22, 205
SsiI CCGC 1 cut(s) 390
SspMI CTAG 2 cut(s) 755, 767
StyD4I CCNGG 2 cut(s) 625, 727
StyI CCWWGG 2 cut(s) 74, 385
TaaI ACNGT 3 cut(s) 93, 301, 611
TaiI ACGT 1 cut(s) 186
TasI AATT 2 cut(s) 22, 205
TatI WGTACW 2 cut(s) 378, 660
Tru1I TTAA 1 cut(s) 513
Tru9I TTAA 1 cut(s) 513
TscAI CASTG 5 cut(s) 319, 343, 543, 616, 754
TseFI GTSAC 2 cut(s) 436, 580
Tsp45I GTSAC 2 cut(s) 436, 580
TspDTI ATGAA 4 cut(s) 232, 432, 722, 946
TspRI CASTG 5 cut(s) 319, 343, 543, 616, 754
Van91I CCANNNNNTGG 1 cut(s) 479
VpaK11BI GGWCC 3 cut(s) 136, 155, 1001
XceI RCATGY 1 cut(s) 434
XspI CTAG 2 cut(s) 755, 767
ZrmI AGTACT 2 cut(s) 380, 662
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.