Rmu_sc0010665.1_g000003

Transmembrane protein 147-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010665.1
OG0016163
Physical Location & Seq
Reverse (-)
11163 .. 13580
2418 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010665.1_g000003.1.cds

Sequence Viewer

Length: 828 bp
atgacggtgtttcacttcttcaactgtgcgattctgacgtttggtcctcacgccgtctactactctgccactcctctatcggagtatgacacactcggcacctccattaaagcagctgtggtttatctcggaacagctctagtcaagcttgtttgtttggctacttttctcaaggtatctgataatgaaagcttcgatccatatcaggaattgttgaaagctttgatcggcttcatagatgttgctggcctttactttgctttgacccagttgacccataggaacatctctcaaaatcataaatttcaagcagtgggacttgggtgggcttttgctgattcggttctccatagattggcacctctgtgggtgggtgccagaggactagaatttacctgggattacattctgcaaggccttgaggcaaatgcaaatctggttttgagcatatcccttgctgcattgggatctttgatgtggcttcgcaaaaacaagcctaagacgctgattcctataatatacatctgtgctgggattgtggcaaccatgccatctatcacaagctatctaaggcgtgccctggggtggcacttcccggaggtggtaggatttcaactctttacctctctgatcatggcattcatcagctggcagctctttgctgcatccattttttggcagagaagagcggacgaaattgaagacgagactgaagagtgtgctgctagtgaacacgaagcggatgggctggttgcggaaggcgttttgccggaggggtcggattgggaccatccgacgattgtgttagtttgggaattggagccgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2053

Protein Analysis

275

Amino Acids

30.63

Weight (kDa)

5.01

Isoelectric Point (pI)

35.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016163)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G47640
fragaria_vesca FvH4_2g40630
malus_domestica MD08G1039400.v1.1 MD15G1034100.v1.1
prunus_persica Prupe.1G387900_v2.0.a1
pyrus_communis pycom08g03150 pycom15g03140
rosa_chinensis RchiOBHm_Chr6g0300041
rosa_laevigata RLG00000011370
rosa_multiflora Rmu_sc0010665.1_g000003
rosa_roxburghii Rroxscaffold_7G00168170
rosa_rugosa Rorug06G0293800
rosa_samantha Rh6BG413700 Rh6DG406400
rosa_wichuraiana Rw6G035480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 98, 358, 374
AccB7I CCANNNNNTGG 2 cut(s) 355, 675
AccBSI CCGCTC 1 cut(s) 689
AccI GTMKAC 1 cut(s) 57
AciI CCGC 3 cut(s) 689, 740, 755
AclWI GGATC 2 cut(s) 191, 475
AcsI RAATTY 2 cut(s) 302, 389
AcuI CTGAAG 1 cut(s) 732
AfiI CCNNNNNNNGG 4 cut(s) 355, 585, 601, 675
AgsI TTSAA 5 cut(s) 22, 217, 308, 614, 701
AhdI GACNNNNNGTC 1 cut(s) 42
AjnI CCWGG 2 cut(s) 395, 579
AleI CACNNNNGTG 1 cut(s) 364
AluBI AGCT 8 cut(s) 116, 137, 148, 192, 221, 564, 648, 655
AluI AGCT 8 cut(s) 116, 137, 148, 192, 221, 564, 648, 655
Alw26I GTCTC 1 cut(s) 701
AlwI GGATC 2 cut(s) 191, 475
AoxI GGCC 2 cut(s) 247, 415
ApeKI GCWGC 5 cut(s) 113, 458, 652, 662, 722
ApoI RAATTY 2 cut(s) 302, 389
AspS9I GGNCC 2 cut(s) 44, 787
AsuC2I CCSGG 1 cut(s) 596
AvaII GGWCC 2 cut(s) 44, 787
BaeGI GKGCMC 1 cut(s) 580
BanI GGYRCC 3 cut(s) 98, 358, 374
BbsI GAAGAC 1 cut(s) 708
BbvI GCAGC 5 cut(s) 125, 445, 649, 664, 709
BccI CCATC 3 cut(s) 559, 737, 798
BceAI ACGGC 2 cut(s) 38, 808
BciT130I CCWGG 2 cut(s) 397, 581
BclI TGATCA 1 cut(s) 630
BcnI CCSGG 1 cut(s) 596
BcoDI GTCTC 1 cut(s) 701
BfaI CTAG 3 cut(s) 140, 386, 726
BisI GCNGC 5 cut(s) 114, 459, 653, 663, 723
BlsI GCNGC 5 cut(s) 115, 460, 654, 664, 724
Bme1390I CCNGG 3 cut(s) 397, 581, 596
Bme18I GGWCC 2 cut(s) 44, 787
BmeRI GACNNNNNGTC 1 cut(s) 42
BmgT120I GGNCC 2 cut(s) 44, 787
BmiI GGNNCC 5 cut(s) 100, 360, 376, 788, 822
BmrFI CCNGG 3 cut(s) 397, 581, 596
BmrI ACTGGG 1 cut(s) 262
BmsI GCATC 1 cut(s) 674
BmuI ACTGGG 1 cut(s) 262
BpiI GAAGAC 1 cut(s) 708
BpuEI CTTGAG 2 cut(s) 155, 440
BpuMI CCSGG 1 cut(s) 596
BsaBI GATNNNNATC 1 cut(s) 201
BsaJI CCNNGG 3 cut(s) 396, 579, 580
Bsc4I CCNNNNNNNGG 4 cut(s) 355, 585, 601, 675
Bse1I ACTGG 1 cut(s) 268
Bse8I GATNNNNATC 1 cut(s) 201
BseBI CCWGG 2 cut(s) 397, 581
BseDI CCNNGG 3 cut(s) 396, 579, 580
BseGI GGATG 3 cut(s) 665, 748, 790
BseJI GATNNNNATC 1 cut(s) 201
BseLI CCNNNNNNNGG 4 cut(s) 355, 585, 601, 675
BseNI ACTGG 1 cut(s) 268
BseRI GAGGAG 1 cut(s) 63
BseSI GKGCMC 1 cut(s) 580
BseXI GCAGC 5 cut(s) 125, 445, 649, 664, 709
BseYI CCCAGC 1 cut(s) 530
BshFI GGCC 2 cut(s) 249, 417
BshNI GGYRCC 3 cut(s) 98, 358, 374
BsiSI CCGG 2 cut(s) 596, 770
BslFI GGGAC 2 cut(s) 330, 800
BslI CCNNNNNNNGG 4 cut(s) 355, 585, 601, 675
BsmAI GTCTC 1 cut(s) 701
BsmFI GGGAC 2 cut(s) 330, 800
BsmI GAATGC 1 cut(s) 638
BsnI GGCC 2 cut(s) 249, 417
Bsp1286I GDGCHC 1 cut(s) 580
Bsp143I GATC 4 cut(s) 196, 225, 467, 630
BspACI CCGC 3 cut(s) 689, 740, 755
BspANI GGCC 2 cut(s) 249, 417
BspLI GGNNCC 5 cut(s) 100, 360, 376, 788, 822
BspPI GGATC 2 cut(s) 191, 475
BspQI GCTCTTC 1 cut(s) 679
BspT107I GGYRCC 3 cut(s) 98, 358, 374
BsrBI CCGCTC 1 cut(s) 689
BsrI ACTGG 1 cut(s) 268
BssECI CCNNGG 3 cut(s) 396, 579, 580
BssMI GATC 4 cut(s) 196, 225, 467, 630
Bst2UI CCWGG 2 cut(s) 397, 581
Bst4CI ACNGT 2 cut(s) 7, 26
Bst6I CTCTTC 2 cut(s) 679, 708
BstC8I GCNNGC 3 cut(s) 247, 576, 650
BstDEI CTNAG 2 cut(s) 498, 569
BstF5I GGATG 3 cut(s) 665, 748, 790
BstKTI GATC 4 cut(s) 199, 228, 470, 633
BstMAI GTCTC 1 cut(s) 701
BstMBI GATC 4 cut(s) 196, 225, 467, 630
BstMWI GCNNNNNNNGC 1 cut(s) 502
BstNI CCWGG 2 cut(s) 397, 581
BstSCI CCNGG 3 cut(s) 395, 579, 594
BstSLI GKGCMC 1 cut(s) 580
BstV1I GCAGC 5 cut(s) 125, 445, 649, 664, 709
BstV2I GAAGAC 1 cut(s) 708
BstX2I RGATCY 1 cut(s) 467
BstYI RGATCY 1 cut(s) 467
BsuRI GGCC 2 cut(s) 249, 417
BtsCI GGATG 3 cut(s) 665, 748, 790
BtsI GCAGTG 1 cut(s) 318
BtsIMutI CAGTG 1 cut(s) 318
Cac8I GCNNGC 3 cut(s) 247, 576, 650
Cfr13I GGNCC 2 cut(s) 44, 787
CseI GACGC 1 cut(s) 511
CviAII CATG 2 cut(s) 547, 634
DdeI CTNAG 2 cut(s) 498, 569
DpnI GATC 4 cut(s) 198, 227, 469, 632
DpnII GATC 4 cut(s) 196, 225, 467, 630
DriI GACNNNNNGTC 1 cut(s) 42
Eam1104I CTCTTC 2 cut(s) 679, 708
Eam1105I GACNNNNNGTC 1 cut(s) 42
EarI CTCTTC 2 cut(s) 679, 708
Eco147I AGGCCT 1 cut(s) 417
Eco47I GGWCC 2 cut(s) 44, 787
Eco57I CTGAAG 1 cut(s) 732
EcoRII CCWGG 2 cut(s) 395, 579
FaeI CATG 2 cut(s) 550, 637
FaqI GGGAC 2 cut(s) 330, 800
FatI CATG 2 cut(s) 546, 633
FbaI TGATCA 1 cut(s) 630
FblI GTMKAC 1 cut(s) 57
Fnu4HI GCNGC 5 cut(s) 114, 459, 653, 663, 723
FokI GGATG 3 cut(s) 652, 755, 777
Fsp4HI GCNGC 5 cut(s) 114, 459, 653, 663, 723
FspBI CTAG 3 cut(s) 140, 386, 726
GluI GCNGC 5 cut(s) 114, 459, 653, 663, 723
GsaI CCCAGC 1 cut(s) 534
HaeIII GGCC 2 cut(s) 249, 417
HapII CCGG 2 cut(s) 596, 770
HgaI GACGC 1 cut(s) 511
Hin1II CATG 2 cut(s) 550, 637
HincII GTYRAC 1 cut(s) 273
HindII GTYRAC 1 cut(s) 273
HindIII AAGCTT 3 cut(s) 146, 190, 219
HinfI GANTC 3 cut(s) 31, 338, 508
HpaII CCGG 2 cut(s) 596, 770
Hpy166II GTNNAC 3 cut(s) 58, 273, 731
Hpy188I TCNGA 7 cut(s) 36, 82, 131, 181, 630, 781, 795
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 3 cut(s) 58, 273, 731
Hpy99I CGWCG 1 cut(s) 799
HpyAV CCTTC 1 cut(s) 752
HpyCH4III ACNGT 2 cut(s) 7, 26
HpyCH4IV ACGT 1 cut(s) 38
HpyCH4V TGCA 4 cut(s) 412, 431, 461, 665
HpyF10VI GCNNNNNNNGC 1 cut(s) 502
HpyF3I CTNAG 2 cut(s) 498, 569
HpySE526I ACGT 1 cut(s) 38
Hsp92II CATG 2 cut(s) 550, 637
Ksp22I TGATCA 1 cut(s) 630
Kzo9I GATC 4 cut(s) 196, 225, 467, 630
LguI GCTCTTC 1 cut(s) 679
LmnI GCTCC 1 cut(s) 820
Lsp1109I GCAGC 5 cut(s) 125, 445, 649, 664, 709
LweI GCATC 1 cut(s) 674
MaeI CTAG 3 cut(s) 140, 386, 726
MaeII ACGT 1 cut(s) 38
MalI GATC 4 cut(s) 198, 227, 469, 632
MbiI CCGCTC 1 cut(s) 689
MboI GATC 4 cut(s) 196, 225, 467, 630
MboII GAAGA 4 cut(s) 10, 696, 713, 725
MflI RGATCY 1 cut(s) 467
MhlI GDGCHC 1 cut(s) 580
MluCI AATT 5 cut(s) 209, 302, 389, 696, 815
MmeI TCCRAC 2 cut(s) 759, 818
MnlI CCTC 9 cut(s) 57, 84, 112, 372, 374, 415, 592, 634, 766
MseI TTAA 1 cut(s) 108
MslI CAYNNNNRTG 1 cut(s) 364
MspA1I CMGCKG 2 cut(s) 116, 648
MspI CCGG 2 cut(s) 596, 770
MspR9I CCNGG 3 cut(s) 397, 581, 596
Mva1269I GAATGC 1 cut(s) 638
MvaI CCWGG 2 cut(s) 397, 581
MwoI GCNNNNNNNGC 1 cut(s) 502
NciI CCSGG 1 cut(s) 596
NdeII GATC 4 cut(s) 196, 225, 467, 630
NlaIII CATG 2 cut(s) 550, 637
NlaIV GGNNCC 5 cut(s) 100, 360, 376, 788, 822
NmeAIII GCCGAG 1 cut(s) 75
OliI CACNNNNGTG 1 cut(s) 364
PasI CCCWGGG 1 cut(s) 580
PceI AGGCCT 1 cut(s) 417
PciSI GCTCTTC 1 cut(s) 679
PctI GAATGC 1 cut(s) 638
PfeI GAWTC 3 cut(s) 31, 338, 508
PflMI CCANNNNNTGG 2 cut(s) 355, 675
PfoI TCCNGGA 1 cut(s) 594
PkrI GCNGC 5 cut(s) 115, 460, 654, 664, 724
Psp6I CCWGG 2 cut(s) 395, 579
PspFI CCCAGC 1 cut(s) 530
PspGI CCWGG 2 cut(s) 395, 579
PspN4I GGNNCC 5 cut(s) 100, 360, 376, 788, 822
PspPI GGNCC 2 cut(s) 44, 787
PsuI RGATCY 1 cut(s) 467
PvuII CAGCTG 2 cut(s) 116, 648
RseI CAYNNNNRTG 1 cut(s) 364
SapI GCTCTTC 1 cut(s) 679
SaqAI TTAA 1 cut(s) 108
SatI GCNGC 5 cut(s) 114, 459, 653, 663, 723
Sau3AI GATC 4 cut(s) 196, 225, 467, 630
Sau96I GGNCC 2 cut(s) 44, 787
ScrFI CCNGG 3 cut(s) 397, 581, 596
SduI GDGCHC 1 cut(s) 580
SfaNI GCATC 1 cut(s) 674
SinI GGWCC 2 cut(s) 44, 787
SmiMI CAYNNNNRTG 1 cut(s) 364
SmlI CTYRAG 2 cut(s) 170, 419
SmoI CTYRAG 2 cut(s) 170, 419
Sse9I AATT 5 cut(s) 209, 302, 389, 696, 815
SseBI AGGCCT 1 cut(s) 417
SsiI CCGC 3 cut(s) 689, 740, 755
SspMI CTAG 3 cut(s) 140, 386, 726
StuI AGGCCT 1 cut(s) 417
StyD4I CCNGG 3 cut(s) 395, 579, 594
TaaI ACNGT 2 cut(s) 7, 26
TaiI ACGT 1 cut(s) 41
TaqI TCGA 1 cut(s) 195
TasI AATT 5 cut(s) 209, 302, 389, 696, 815
TfiI GAWTC 3 cut(s) 31, 338, 508
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TscAI CASTG 1 cut(s) 318
TseI GCWGC 5 cut(s) 113, 458, 652, 662, 722
TspDTI ATGAA 3 cut(s) 201, 223, 631
TspRI CASTG 1 cut(s) 318
Van91I CCANNNNNTGG 2 cut(s) 355, 675
VpaK11BI GGWCC 2 cut(s) 44, 787
XapI RAATTY 2 cut(s) 302, 389
XmiI GTMKAC 1 cut(s) 57
XspI CTAG 3 cut(s) 140, 386, 726
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.