Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011027.1

Orthogroup ID

OG0017977

Physical Location & Seq

Genomic Coordinates Reverse (-)

10214 .. 10564

Gene Structure 351 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011027.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 351 bp

atgataattgagttaatttctagcagcatgcctgatgtcccagaagatgaacaccctgacattattggaaaaacatttgaggcggttgaaggggctgttctcgggctgcctattgatattgtcattgtggataccacaatccgcttattgggctgtgcaagaactgttgaagaatatcacttgattgttggcagggttacgatggacttcatgcatatttccaagcgtattgctgcaactaaattatccattgacggcttggagaaagtgacactcgatagtttggatcttactgtgagaaaacgccctgtattatttgtagggaagatcttgatcacattgatcttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000122 GO:0003674 GO:0003824 GO:0004842 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005829 GO:0006355 GO:0006357 GO:0006464 GO:0006508 GO:0006511 GO:0006807 GO:0007549 GO:0008150 GO:0008152 GO:0009048 GO:0009056 GO:0009057 GO:0009889 GO:0009890 GO:0009892 GO:0009987 GO:0010468 GO:0010498 GO:0010556 GO:0010558 GO:0010605 GO:0010629 GO:0016567 GO:0016740 GO:0019219 GO:0019222 GO:0019538 GO:0019787 GO:0019941 GO:0030163 GO:0031323 GO:0031324 GO:0031326 GO:0031327 GO:0031974 GO:0031981 GO:0032446 GO:0036211 GO:0040029 GO:0043161 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043412 GO:0043433 GO:0043632 GO:0044092 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0045892 GO:0045934 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0051090 GO:0051171 GO:0051172 GO:0051252 GO:0051253 GO:0051603 GO:0060255 GO:0060816 GO:0061630 GO:0061659 GO:0065007 GO:0065009 GO:0070013 GO:0070647 GO:0071704 GO:0080090 GO:0140096 GO:1900095 GO:1901564 GO:1901565 GO:1901575 GO:1902679 GO:1903506 GO:1903507 GO:2000112 GO:2000113 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PA zf-RING_2

Protein Analysis

116

Amino Acids

12.81

Weight (kDa)

5.07

Isoelectric Point (pI)

39.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017977)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g05200
rosa_chinensis	RchiOBHm_Chr6g0255331
rosa_multiflora	Rmu_sc0000903.1_g000028 Rmu_sc0004590.1_g000005 Rmu_sc0011027.1_g000004
rosa_roxburghii	Rroxscaffold_7G00210100 Rroxscaffold_7G00210130 Rroxscaffold_7G00210160
rosa_samantha	Rh6BG068900
rosa_wichuraiana	Rw6G006500 Rw6G006550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	83, 142
AclWI	GGATC	1 cut(s)	294
AfiI	CCNNNNNNNGG	1 cut(s)	148
AgsI	TTSAA	2 cut(s)	89, 170
AlwI	GGATC	1 cut(s)	294
Ama87I	CYCGRG	1 cut(s)	101
ApeKI	GCWGC	3 cut(s)	24, 106, 233
AvaI	CYCGRG	1 cut(s)	101
BbvI	GCAGC	3 cut(s)	36, 93, 220
BccI	CCATC	1 cut(s)	196
BceAI	ACGGC	1 cut(s)	271
BciVI	GTATCC	1 cut(s)	124
BclI	TGATCA	1 cut(s)	333
BfaI	CTAG	1 cut(s)	21
BfuI	GTATCC	1 cut(s)	124
BglII	AGATCT	1 cut(s)	327
BisI	GCNGC	3 cut(s)	25, 107, 234
BlsI	GCNGC	3 cut(s)	26, 108, 235
BmeT110I	CYCGRG	1 cut(s)	101
BsaBI	GATNNNNATC	1 cut(s)	332
Bsc4I	CCNNNNNNNGG	1 cut(s)	148
Bse8I	GATNNNNATC	1 cut(s)	332
BseJI	GATNNNNATC	1 cut(s)	332
BseLI	CCNNNNNNNGG	1 cut(s)	148
BseXI	GCAGC	3 cut(s)	36, 93, 220
BsiHKCI	CYCGRG	1 cut(s)	101
BslFI	GGGAC	1 cut(s)	23
BslI	CCNNNNNNNGG	1 cut(s)	148
BsmFI	GGGAC	1 cut(s)	23
BsoBI	CYCGRG	1 cut(s)	101
Bsp143I	GATC	4 cut(s)	286, 327, 333, 342
BspACI	CCGC	2 cut(s)	83, 142
BspPI	GGATC	1 cut(s)	294
BssMI	GATC	4 cut(s)	286, 327, 333, 342
Bst4CI	ACNGT	2 cut(s)	166, 295
BstC8I	GCNNGC	1 cut(s)	29
BstKTI	GATC	4 cut(s)	289, 330, 336, 345
BstMBI	GATC	4 cut(s)	286, 327, 333, 342
BstMWI	GCNNNNNNNGC	1 cut(s)	150
BstNSI	RCATGY	1 cut(s)	31
BstV1I	GCAGC	3 cut(s)	36, 93, 220
BstX2I	RGATCY	2 cut(s)	286, 327
BstYI	RGATCY	2 cut(s)	286, 327
BsuI	GTATCC	1 cut(s)	124
Cac8I	GCNNGC	1 cut(s)	29
CviAII	CATG	2 cut(s)	28, 211
CviJI	RGCY	4 cut(s)	95, 106, 153, 258
CviKI_1	RGCY	4 cut(s)	95, 106, 153, 258
DpnI	GATC	4 cut(s)	288, 329, 335, 344
DpnII	GATC	4 cut(s)	286, 327, 333, 342
Eco88I	CYCGRG	1 cut(s)	101
EcoT22I	ATGCAT	1 cut(s)	216
FaeI	CATG	2 cut(s)	31, 214
FaiI	YATR	3 cut(s)	29, 212, 216
FaqI	GGGAC	1 cut(s)	23
FatI	CATG	2 cut(s)	27, 210
FbaI	TGATCA	1 cut(s)	333
Fnu4HI	GCNGC	3 cut(s)	25, 107, 234
Fsp4HI	GCNGC	3 cut(s)	25, 107, 234
FspBI	CTAG	1 cut(s)	21
GluI	GCNGC	3 cut(s)	25, 107, 234
Hin1II	CATG	2 cut(s)	31, 214
Hpy188III	TCNNGA	1 cut(s)	331
HpyAV	CCTTC	1 cut(s)	83
HpyCH4III	ACNGT	2 cut(s)	166, 295
HpyCH4V	TGCA	3 cut(s)	158, 214, 236
HpyF10VI	GCNNNNNNNGC	1 cut(s)	150
Hsp92II	CATG	2 cut(s)	31, 214
Ksp22I	TGATCA	1 cut(s)	333
Kzo9I	GATC	4 cut(s)	286, 327, 333, 342
LpnPI	CCDG	5 cut(s)	45, 54, 69, 178, 321
Lsp1109I	GCAGC	3 cut(s)	36, 93, 220
MaeI	CTAG	1 cut(s)	21
MaeIII	GTNAC	2 cut(s)	196, 268
MalI	GATC	4 cut(s)	288, 329, 335, 344
MboI	GATC	4 cut(s)	286, 327, 333, 342
MboII	GAAGA	3 cut(s)	56, 182, 337
MflI	RGATCY	2 cut(s)	286, 327
MluCI	AATT	3 cut(s)	6, 15, 242
MnlI	CCTC	1 cut(s)	73
Mph1103I	ATGCAT	1 cut(s)	216
MseI	TTAA	1 cut(s)	14
MwoI	GCNNNNNNNGC	1 cut(s)	150
NdeII	GATC	4 cut(s)	286, 327, 333, 342
NlaIII	CATG	2 cut(s)	31, 214
NmuCI	GTSAC	1 cut(s)	268
NsiI	ATGCAT	1 cut(s)	216
NspI	RCATGY	1 cut(s)	31
PaeI	GCATGC	1 cut(s)	31
PkrI	GCNGC	3 cut(s)	26, 108, 235
PsuI	RGATCY	2 cut(s)	286, 327
SaqAI	TTAA	1 cut(s)	14
SatI	GCNGC	3 cut(s)	25, 107, 234
Sau3AI	GATC	4 cut(s)	286, 327, 333, 342
SphI	GCATGC	1 cut(s)	31
Sse9I	AATT	3 cut(s)	6, 15, 242
SsiI	CCGC	2 cut(s)	83, 142
SspMI	CTAG	1 cut(s)	21
TaaI	ACNGT	2 cut(s)	166, 295
TaqI	TCGA	1 cut(s)	276
TasI	AATT	3 cut(s)	6, 15, 242
Tru1I	TTAA	1 cut(s)	14
Tru9I	TTAA	1 cut(s)	14
TseFI	GTSAC	1 cut(s)	268
TseI	GCWGC	3 cut(s)	24, 106, 233
Tsp45I	GTSAC	1 cut(s)	268
TspDTI	ATGAA	2 cut(s)	63, 199
XceI	RCATGY	1 cut(s)	31
XcmI	CCANNNNNNNNNTGG	1 cut(s)	256
XspI	CTAG	1 cut(s)	21
Zsp2I	ATGCAT	1 cut(s)	216

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.