Rmu_sc0011951.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011951.1
OG0015522
Physical Location & Seq
Forward (+)
6234 .. 6764
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011951.1_g000003.1.cds

Sequence Viewer

Length: 531 bp
atgaatcttaaagctgtggatgggaatgaaatgtttcagggtctatccaagtctgctggtttggaccttatacagaattgtgatcttcctccacccatgaaagtcttcacaggttctgcagacaagactgttgtgtcatccatgaacagaatttgcagcatgatggcccgagaagatcacgaaaacagccacgagttaatcgacatgtatagaggagacggcgatcagaattgtgggaagctggagctcttgaaagccttgaggctttcgcaaacaagagcgagggaggcagagaagaaggctgagaagttggcaaaggaaaaggaatgtctttccaatgctctgctcgctgaggcgaaagagctttttgcttaccggcaatgggtgaggttgcttgagctaaaagtttcgaagctgcattcacaatttgcagaacaagaacatcaggaatgctgtggctgtgagacttggattgtagctttggcactttgtttggggattgctggtgttgggtttgcatactttaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

176

Amino Acids

19.67

Weight (kDa)

5.85

Isoelectric Point (pI)

19.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015522)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g20210
malus_domestica MD01G1036700.v1.1 MD15G1317900.v1.1
prunus_persica Prupe.6G193900_v2.0.a1
pyrus_communis pycom15g28050
rosa_chinensis RchiOBHm_Chr2g0112271
rosa_laevigata RLG00000017967
rosa_multiflora Rmu_sc0004467.1_g000025 Rmu_sc0011951.1_g000003
rosa_roxburghii Rroxscaffold_2G00131570
rosa_rugosa Rorug02G0179800
rosa_samantha Rh2AG232300 Rh2BG245600 Rh2CG236500 Rh2DG240000
rosa_wichuraiana Rw2G018010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 133
AcsI RAATTY 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 382
AflIII ACRYGT 1 cut(s) 204
AgsI TTSAA 1 cut(s) 253
AluBI AGCT 7 cut(s) 14, 241, 247, 364, 400, 415, 479
AluI AGCT 7 cut(s) 14, 241, 247, 364, 400, 415, 479
Alw21I GWGCWC 1 cut(s) 249
Alw26I GTCTC 2 cut(s) 210, 458
AlwNI CAGNNNCTG 1 cut(s) 116
Ama87I CYCGRG 1 cut(s) 168
AoxI GGCC 1 cut(s) 165
ApeKI GCWGC 2 cut(s) 156, 415
ApoI RAATTY 1 cut(s) 150
Asp700I GAANNNNTTC 2 cut(s) 33, 104
AspS9I GGNCC 2 cut(s) 64, 166
AsuHPI GGTGA 1 cut(s) 397
AsuII TTCGAA 1 cut(s) 410
AvaI CYCGRG 1 cut(s) 168
AvaII GGWCC 1 cut(s) 64
BanII GRGCYC 1 cut(s) 249
BauI CACGAG 1 cut(s) 191
BbsI GAAGAC 1 cut(s) 97
Bbv12I GWGCWC 1 cut(s) 249
BbvCI CCTCAGC 1 cut(s) 351
BbvI GCAGC 2 cut(s) 168, 402
BccI CCATC 2 cut(s) 14, 157
BceAI ACGGC 1 cut(s) 235
BcoDI GTCTC 2 cut(s) 210, 458
BfmI CTRYAG 1 cut(s) 117
BisI GCNGC 2 cut(s) 157, 416
BlsI GCNGC 2 cut(s) 158, 417
Bme18I GGWCC 1 cut(s) 64
BmeT110I CYCGRG 1 cut(s) 168
BmgT120I GGNCC 2 cut(s) 64, 166
BpiI GAAGAC 1 cut(s) 97
BpmI CTGGAG 1 cut(s) 263
Bpu10I CCTNAGC 1 cut(s) 351
Bpu14I TTCGAA 1 cut(s) 410
BpuEI CTTGAG 2 cut(s) 280, 416
Bsc4I CCNNNNNNNGG 1 cut(s) 382
Bse118I RCCGGY 1 cut(s) 375
Bse3DI GCAATG 1 cut(s) 386
BseGI GGATG 2 cut(s) 25, 137
BseLI CCNNNNNNNGG 1 cut(s) 382
BseMI GCAATG 1 cut(s) 386
BseMII CTCAG 2 cut(s) 294, 342
BseRI GAGGAG 1 cut(s) 228
BseXI GCAGC 2 cut(s) 168, 402
BshFI GGCC 1 cut(s) 167
BsiHKAI GWGCWC 1 cut(s) 249
BsiHKCI CYCGRG 1 cut(s) 168
BsiSI CCGG 1 cut(s) 376
BslI CCNNNNNNNGG 1 cut(s) 382
BsmAI GTCTC 2 cut(s) 210, 458
BsmBI CGTCTC 1 cut(s) 210
BsmI GAATGC 2 cut(s) 418, 455
BsnI GGCC 1 cut(s) 167
BsoBI CYCGRG 1 cut(s) 168
Bsp119I TTCGAA 1 cut(s) 410
Bsp1286I GDGCHC 1 cut(s) 249
Bsp143I GATC 3 cut(s) 82, 175, 223
BspANI GGCC 1 cut(s) 167
BspCNI CTCAG 2 cut(s) 295, 343
BspMAI CTGCAG 1 cut(s) 121
BspT104I TTCGAA 1 cut(s) 410
BsrDI GCAATG 1 cut(s) 386
BsrFI RCCGGY 1 cut(s) 375
BssAI RCCGGY 1 cut(s) 375
BssMI GATC 3 cut(s) 82, 175, 223
BssSI CACGAG 1 cut(s) 191
Bst2BI CACGAG 1 cut(s) 191
Bst4CI ACNGT 1 cut(s) 130
BstBI TTCGAA 1 cut(s) 410
BstC8I GCNNGC 1 cut(s) 348
BstDEI CTNAG 2 cut(s) 303, 351
BstF5I GGATG 2 cut(s) 25, 137
BstKTI GATC 3 cut(s) 85, 178, 226
BstMAI GTCTC 2 cut(s) 210, 458
BstMBI GATC 3 cut(s) 82, 175, 223
BstMWI GCNNNNNNNGC 2 cut(s) 287, 347
BstNSI RCATGY 1 cut(s) 208
BstSFI CTRYAG 1 cut(s) 117
BstV1I GCAGC 2 cut(s) 168, 402
BstV2I GAAGAC 1 cut(s) 97
BsuRI GGCC 1 cut(s) 167
BtsCI GGATG 2 cut(s) 25, 137
Cac8I GCNNGC 1 cut(s) 348
CaiI CAGNNNCTG 1 cut(s) 116
Cfr10I RCCGGY 1 cut(s) 375
Cfr13I GGNCC 2 cut(s) 64, 166
CviAII CATG 4 cut(s) 97, 142, 160, 205
DdeI CTNAG 2 cut(s) 303, 351
DpnI GATC 3 cut(s) 84, 177, 225
DpnII GATC 3 cut(s) 82, 175, 223
DrdI GACNNNNNNGTC 1 cut(s) 133
DseDI GACNNNNNNGTC 1 cut(s) 133
Ecl136II GAGCTC 1 cut(s) 247
Eco24I GRGCYC 1 cut(s) 249
Eco47I GGWCC 1 cut(s) 64
Eco53kI GAGCTC 1 cut(s) 247
Eco88I CYCGRG 1 cut(s) 168
EcoICRI GAGCTC 1 cut(s) 247
EcoT38I GRGCYC 1 cut(s) 249
Esp3I CGTCTC 1 cut(s) 210
FaeI CATG 4 cut(s) 100, 145, 163, 208
FaiI YATR 7 cut(s) 71, 98, 143, 161, 206, 210, 520
FatI CATG 4 cut(s) 96, 141, 159, 204
Fnu4HI GCNGC 2 cut(s) 157, 416
FokI GGATG 2 cut(s) 32, 124
FriOI GRGCYC 1 cut(s) 249
Fsp4HI GCNGC 2 cut(s) 157, 416
GluI GCNGC 2 cut(s) 157, 416
GsuI CTGGAG 1 cut(s) 263
HaeIII GGCC 1 cut(s) 167
HapII CCGG 1 cut(s) 376
Hin1II CATG 4 cut(s) 100, 145, 163, 208
HinfI GANTC 1 cut(s) 4
HpaII CCGG 1 cut(s) 376
HphI GGTGA 1 cut(s) 397
Hpy188I TCNGA 1 cut(s) 228
Hpy188III TCNNGA 3 cut(s) 179, 250, 446
HpyAV CCTTC 1 cut(s) 292
HpyCH4III ACNGT 1 cut(s) 130
HpyCH4V TGCA 5 cut(s) 119, 156, 418, 431, 518
HpyF10VI GCNNNNNNNGC 2 cut(s) 287, 347
HpyF3I CTNAG 2 cut(s) 303, 351
Hsp92II CATG 4 cut(s) 100, 145, 163, 208
Kzo9I GATC 3 cut(s) 82, 175, 223
LmnI GCTCC 1 cut(s) 244
LpnPI CCDG 7 cut(s) 23, 42, 96, 227, 389, 431, 489
Lsp1109I GCAGC 2 cut(s) 168, 402
MalI GATC 3 cut(s) 84, 177, 225
MboI GATC 3 cut(s) 82, 175, 223
MboII GAAGA 4 cut(s) 77, 97, 185, 307
MhlI GDGCHC 1 cut(s) 249
MluCI AATT 5 cut(s) 76, 150, 229, 425, 526
MnlI CCTC 7 cut(s) 99, 206, 255, 276, 280, 346, 381
MroXI GAANNNNTTC 2 cut(s) 33, 104
MseI TTAA 3 cut(s) 9, 197, 525
MspI CCGG 1 cut(s) 376
Mva1269I GAATGC 2 cut(s) 418, 455
MwoI GCNNNNNNNGC 2 cut(s) 287, 347
NdeII GATC 3 cut(s) 82, 175, 223
NlaIII CATG 4 cut(s) 100, 145, 163, 208
NspI RCATGY 1 cut(s) 208
NspV TTCGAA 1 cut(s) 410
PciI ACATGT 1 cut(s) 204
PcsI WCGNNNNNNNCGW 1 cut(s) 198
PctI GAATGC 2 cut(s) 418, 455
PdmI GAANNNNTTC 2 cut(s) 33, 104
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 158, 417
PscI ACATGT 1 cut(s) 204
Psp124BI GAGCTC 1 cut(s) 249
PspPI GGNCC 2 cut(s) 64, 166
PstI CTGCAG 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 116
SacI GAGCTC 1 cut(s) 249
SaqAI TTAA 3 cut(s) 9, 197, 525
SatI GCNGC 2 cut(s) 157, 416
Sau3AI GATC 3 cut(s) 82, 175, 223
Sau96I GGNCC 2 cut(s) 64, 166
SduI GDGCHC 1 cut(s) 249
SfcI CTRYAG 1 cut(s) 117
SfuI TTCGAA 1 cut(s) 410
SinI GGWCC 1 cut(s) 64
SmlI CTYRAG 2 cut(s) 259, 395
SmoI CTYRAG 2 cut(s) 259, 395
Sse9I AATT 5 cut(s) 76, 150, 229, 425, 526
SstI GAGCTC 1 cut(s) 249
TaaI ACNGT 1 cut(s) 130
TaqI TCGA 2 cut(s) 201, 410
TasI AATT 5 cut(s) 76, 150, 229, 425, 526
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 3 cut(s) 9, 197, 525
Tru9I TTAA 3 cut(s) 9, 197, 525
TseI GCWGC 2 cut(s) 156, 415
TspDTI ATGAA 4 cut(s) 17, 42, 113, 158
VpaK11BI GGWCC 1 cut(s) 64
XapI RAATTY 1 cut(s) 150
XceI RCATGY 1 cut(s) 208
XmnI GAANNNNTTC 2 cut(s) 33, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.