Rmu_sc0012889.1_g000001

Trimethylguanosine synthase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012889.1
Physical Location & Seq
Forward (+)
1 .. 1931
1931 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012889.1_g000001.1.cds

Sequence Viewer

Length: 211 bp
atatgccatatttcaagctgctcaagcgataacgcccaacatcattatgttcttacctcgaaatgtagacttactccaagttgaagaactctgttggttgtcttctcctcctctagaatttgagattgaagaaaattatgtgcagggcaatttaaagggtgtaacagtctactttggtggtgcagcagccagtcaatgtggaccatcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.56

Weight (kDa)

4.06

Isoelectric Point (pI)

59.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 67, 169
AcsI RAATTY 1 cut(s) 117
AgsI TTSAA 3 cut(s) 15, 84, 129
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
ApeKI GCWGC 3 cut(s) 18, 183, 186
ApoI RAATTY 1 cut(s) 117
AspS9I GGNCC 1 cut(s) 201
AvaII GGWCC 1 cut(s) 201
BbsI GAAGAC 1 cut(s) 94
BbvI GCAGC 3 cut(s) 5, 195, 198
BfaI CTAG 1 cut(s) 114
BisI GCNGC 3 cut(s) 19, 184, 187
BlsI GCNGC 3 cut(s) 20, 185, 188
Bme18I GGWCC 1 cut(s) 201
BmgT120I GGNCC 1 cut(s) 201
BpiI GAAGAC 1 cut(s) 94
BpuEI CTTGAG 1 cut(s) 7
Bse1I ACTGG 1 cut(s) 190
BseNI ACTGG 1 cut(s) 190
BseRI GAGGAG 2 cut(s) 97, 100
BseXI GCAGC 3 cut(s) 5, 195, 198
BsgI GTGCAG 2 cut(s) 162, 202
BsrI ACTGG 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 24
BstV1I GCAGC 3 cut(s) 5, 195, 198
BstV2I GAAGAC 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 201
CviJI RGCY 2 cut(s) 18, 189
CviKI_1 RGCY 2 cut(s) 18, 189
DraI TTTAAA 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 201
FaiI YATR 5 cut(s) 4, 9, 48, 139, 209
FblI GTMKAC 2 cut(s) 67, 169
Fnu4HI GCNGC 3 cut(s) 19, 184, 187
Fsp4HI GCNGC 3 cut(s) 19, 184, 187
FspBI CTAG 1 cut(s) 114
GluI GCNGC 3 cut(s) 19, 184, 187
Hpy166II GTNNAC 3 cut(s) 68, 170, 201
Hpy188III TCNNGA 1 cut(s) 114
Hpy8I GTNNAC 3 cut(s) 68, 170, 201
HpyCH4III ACNGT 1 cut(s) 167
HpyCH4V TGCA 2 cut(s) 143, 183
HpyF10VI GCNNNNNNNGC 1 cut(s) 24
LpnPI CCDG 2 cut(s) 129, 203
Lsp1109I GCAGC 3 cut(s) 5, 195, 198
MaeI CTAG 1 cut(s) 114
MaeIII GTNAC 1 cut(s) 161
MboII GAAGA 3 cut(s) 94, 96, 141
MluCI AATT 3 cut(s) 117, 134, 149
MnlI CCTC 3 cut(s) 67, 118, 121
MseI TTAA 1 cut(s) 153
MslI CAYNNNNRTG 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 24
PkrI GCNGC 3 cut(s) 20, 185, 188
PspPI GGNCC 1 cut(s) 201
RseI CAYNNNNRTG 1 cut(s) 45
SaqAI TTAA 1 cut(s) 153
SatI GCNGC 3 cut(s) 19, 184, 187
Sau96I GGNCC 1 cut(s) 201
SetI ASST 2 cut(s) 20, 59
SgeI CNNG 7 cut(s) 27, 36, 70, 90, 126, 156, 202
SinI GGWCC 1 cut(s) 201
SmiMI CAYNNNNRTG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 3 cut(s) 117, 134, 149
SspMI CTAG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 167
TaqI TCGA 1 cut(s) 59
TasI AATT 3 cut(s) 117, 134, 149
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TseI GCWGC 3 cut(s) 18, 183, 186
VpaK11BI GGWCC 1 cut(s) 201
XapI RAATTY 1 cut(s) 117
XbaI TCTAGA 1 cut(s) 113
XmiI GTMKAC 2 cut(s) 67, 169
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.