Rh2BG361400

Trimethylguanosine synthase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0007787
Physical Location & Seq
Forward (+)
50008523 .. 50011662
3140 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG361400.1

Sequence Viewer

Length: 393 bp
ATGGCCATTAACAATGCGAGAATATATGGAGTGGAAGATTACATTGATTTCATTGTTGGAGACTTTTTCCAACTTGCACCATCATTGAAGGGGGACATAGTGTTTCTTTCACCACCTTGGGGAGGCCCATCTTACAGAAGAGTGAAGAAATTTACACTGGACTTACTCGAGCCAAAAGATGGATATGCCATATTTCAAGCTGCTCAAGCGATAACGCCCAACATCATTATGTTCTTACCTCGAAATGTAGACTTACTCCAAGTTGAAGAACTGTGTTGGTTGTCTTCTCCTCCTCTAGAATTTGAGATTGAAGAAAATTATGTGCAGGGCAATTTAAAGGGTGTAACAGTCTACTTTGGTGGTGCAGCAGCCAGTCAATGTGGACCATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
Methyltransf_15

Protein Analysis

130

Amino Acids

14.44

Weight (kDa)

4.46

Isoelectric Point (pI)

46.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_15 PF09445 1 - 121 8.8e-27 RNA cap guanine-N2 methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 179
AccI GTMKAC 2 cut(s) 249, 351
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 149, 299
AfiI CCNNNNNNNGG 3 cut(s) 119, 122, 179
AgsI TTSAA 4 cut(s) 88, 197, 266, 311
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
Alw26I GTCTC 1 cut(s) 54
Ama87I CYCGRG 1 cut(s) 167
AoxI GGCC 2 cut(s) 3, 124
ApeKI GCWGC 3 cut(s) 200, 365, 368
ApoI RAATTY 2 cut(s) 149, 299
AspS9I GGNCC 2 cut(s) 125, 383
AsuHPI GGTGA 1 cut(s) 102
AvaI CYCGRG 1 cut(s) 167
AvaII GGWCC 1 cut(s) 383
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 276
BbvI GCAGC 3 cut(s) 187, 377, 380
BccI CCATC 3 cut(s) 88, 136, 173
BcoDI GTCTC 1 cut(s) 54
BfaI CTAG 1 cut(s) 296
BisI GCNGC 3 cut(s) 201, 366, 369
BlsI GCNGC 3 cut(s) 202, 367, 370
Bme18I GGWCC 1 cut(s) 383
BmeT110I CYCGRG 1 cut(s) 167
BmgT120I GGNCC 2 cut(s) 125, 383
BpiI GAAGAC 1 cut(s) 276
BpuEI CTTGAG 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 3 cut(s) 119, 122, 179
Bse1I ACTGG 2 cut(s) 162, 372
BseDI CCNNGG 1 cut(s) 116
BseLI CCNNNNNNNGG 3 cut(s) 119, 122, 179
BseNI ACTGG 2 cut(s) 162, 372
BseRI GAGGAG 2 cut(s) 279, 282
BseXI GCAGC 3 cut(s) 187, 377, 380
BsgI GTGCAG 2 cut(s) 344, 384
BshFI GGCC 2 cut(s) 5, 126
BsiHKCI CYCGRG 1 cut(s) 167
BslFI GGGAC 1 cut(s) 107
BslI CCNNNNNNNGG 3 cut(s) 119, 122, 179
BsmAI GTCTC 1 cut(s) 54
BsmFI GGGAC 1 cut(s) 107
BsnI GGCC 2 cut(s) 5, 126
BsoBI CYCGRG 1 cut(s) 167
BspANI GGCC 2 cut(s) 5, 126
BsrI ACTGG 2 cut(s) 162, 372
BssECI CCNNGG 1 cut(s) 116
BssT1I CCWWGG 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 273, 349
Bst6I CTCTTC 1 cut(s) 133
BstENI CCTNNNNNAGG 1 cut(s) 120
BstMAI GTCTC 1 cut(s) 54
BstMWI GCNNNNNNNGC 1 cut(s) 206
BstV1I GCAGC 3 cut(s) 187, 377, 380
BstV2I GAAGAC 1 cut(s) 276
BsuRI GGCC 2 cut(s) 5, 126
BtsIMutI CAGTG 1 cut(s) 155
Cfr13I GGNCC 2 cut(s) 125, 383
CviJI RGCY 5 cut(s) 5, 126, 172, 200, 371
CviKI_1 RGCY 5 cut(s) 5, 126, 172, 200, 371
DraI TTTAAA 1 cut(s) 336
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 133
EarI CTCTTC 1 cut(s) 133
Eco130I CCWWGG 1 cut(s) 116
Eco47I GGWCC 1 cut(s) 383
Eco88I CYCGRG 1 cut(s) 167
EcoNI CCTNNNNNAGG 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 116
ErhI CCWWGG 1 cut(s) 116
FaiI YATR 8 cut(s) 25, 27, 98, 186, 191, 230, 321, 391
FaqI GGGAC 1 cut(s) 107
FblI GTMKAC 2 cut(s) 249, 351
Fnu4HI GCNGC 3 cut(s) 201, 366, 369
Fsp4HI GCNGC 3 cut(s) 201, 366, 369
FspBI CTAG 1 cut(s) 296
GluI GCNGC 3 cut(s) 201, 366, 369
HaeIII GGCC 2 cut(s) 5, 126
HphI GGTGA 1 cut(s) 102
Hpy166II GTNNAC 3 cut(s) 250, 352, 383
Hpy188III TCNNGA 1 cut(s) 296
Hpy8I GTNNAC 3 cut(s) 250, 352, 383
HpyAV CCTTC 1 cut(s) 82
HpyCH4III ACNGT 2 cut(s) 273, 349
HpyCH4V TGCA 3 cut(s) 77, 325, 365
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
LpnPI CCDG 3 cut(s) 143, 311, 385
Lsp1109I GCAGC 3 cut(s) 187, 377, 380
MaeI CTAG 1 cut(s) 296
MaeIII GTNAC 1 cut(s) 343
MboII GAAGA 6 cut(s) 47, 150, 157, 276, 278, 323
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 4 cut(s) 149, 299, 316, 331
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 2 cut(s) 37, 94
MnlI CCTC 4 cut(s) 116, 249, 300, 303
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 9, 335
MslI CAYNNNNRTG 1 cut(s) 227
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 206
PaeR7I CTCGAG 1 cut(s) 167
PflMI CCANNNNNTGG 1 cut(s) 179
PkrI GCNGC 3 cut(s) 202, 367, 370
PspPI GGNCC 2 cut(s) 125, 383
PspXI VCTCGAGB 1 cut(s) 167
RseI CAYNNNNRTG 1 cut(s) 227
SaqAI TTAA 2 cut(s) 9, 335
SatI GCNGC 3 cut(s) 201, 366, 369
Sau96I GGNCC 2 cut(s) 125, 383
SetI ASST 3 cut(s) 118, 202, 241
Sfr274I CTCGAG 1 cut(s) 167
SinI GGWCC 1 cut(s) 383
SlaI CTCGAG 1 cut(s) 167
SmiMI CAYNNNNRTG 1 cut(s) 227
SmlI CTYRAG 2 cut(s) 167, 204
SmoI CTYRAG 2 cut(s) 167, 204
Sse9I AATT 4 cut(s) 149, 299, 316, 331
SspMI CTAG 1 cut(s) 296
StyI CCWWGG 1 cut(s) 116
TaaI ACNGT 2 cut(s) 273, 349
TaqI TCGA 2 cut(s) 168, 241
TasI AATT 4 cut(s) 149, 299, 316, 331
Tru1I TTAA 2 cut(s) 9, 335
Tru9I TTAA 2 cut(s) 9, 335
TscAI CASTG 1 cut(s) 162
TseI GCWGC 3 cut(s) 200, 365, 368
TspDTI ATGAA 1 cut(s) 40
TspRI CASTG 1 cut(s) 162
Van91I CCANNNNNTGG 1 cut(s) 179
VpaK11BI GGWCC 1 cut(s) 383
XagI CCTNNNNNAGG 1 cut(s) 120
XapI RAATTY 2 cut(s) 149, 299
XbaI TCTAGA 1 cut(s) 295
XhoI CTCGAG 1 cut(s) 167
XmiI GTMKAC 2 cut(s) 249, 351
XspI CTAG 1 cut(s) 296
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.