Rmu_sc0014011.1_g000001

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014011.1
Physical Location & Seq
Forward (+)
1 .. 608
608 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014011.1_g000001.1.cds

Sequence Viewer

Length: 177 bp
gcaacatctgaaactggttcccctgcggatgaaactgaaattgagaagttagaggagaaagcctccaatttgagacaggagcttgtgaagaaaaatgcatatatcaaggttcttatagatcagctacgagatcttgtcacagacatatcaacctggcaaagtccttgttccgtctga
Functional Annotation

Protein Analysis

58

Amino Acids

6.49

Weight (kDa)

4.58

Isoelectric Point (pI)

59.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 26
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 2 cut(s) 82, 124
AluI AGCT 2 cut(s) 82, 124
Alw26I GTCTC 1 cut(s) 67
BciT130I CCWGG 1 cut(s) 154
BcoDI GTCTC 1 cut(s) 67
BglII AGATCT 1 cut(s) 130
Bme1390I CCNGG 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 154
BplI GAGNNNNNCTC 2 cut(s) 47, 79
Bse1I ACTGG 1 cut(s) 19
BseBI CCWGG 1 cut(s) 154
BseGI GGATG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 19
BseRI GAGGAG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 67
Bsp143I GATC 2 cut(s) 118, 130
BspACI CCGC 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 19
BsrI ACTGG 1 cut(s) 19
BssMI GATC 2 cut(s) 118, 130
Bst2UI CCWGG 1 cut(s) 154
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 2 cut(s) 121, 133
BstMAI GTCTC 1 cut(s) 67
BstMBI GATC 2 cut(s) 118, 130
BstNI CCWGG 1 cut(s) 154
BstSCI CCNGG 1 cut(s) 152
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
BtsCI GGATG 1 cut(s) 34
CviJI RGCY 3 cut(s) 62, 82, 124
CviKI_1 RGCY 3 cut(s) 62, 82, 124
DpnI GATC 2 cut(s) 120, 132
DpnII GATC 2 cut(s) 118, 130
EcoRII CCWGG 1 cut(s) 152
EcoT22I ATGCAT 1 cut(s) 100
FaiI YATR 4 cut(s) 100, 102, 116, 146
FokI GGATG 1 cut(s) 41
Hpy188I TCNGA 2 cut(s) 10, 176
HpyCH4V TGCA 1 cut(s) 98
Kzo9I GATC 2 cut(s) 118, 130
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 4 cut(s) 36, 62, 139, 166
MaeIII GTNAC 1 cut(s) 136
MalI GATC 2 cut(s) 120, 132
MboI GATC 2 cut(s) 118, 130
MboII GAAGA 1 cut(s) 100
MflI RGATCY 1 cut(s) 130
MluCI AATT 2 cut(s) 39, 67
MnlI CCTC 2 cut(s) 46, 73
Mph1103I ATGCAT 1 cut(s) 100
MspR9I CCNGG 1 cut(s) 154
MvaI CCWGG 1 cut(s) 154
NdeII GATC 2 cut(s) 118, 130
NlaIV GGNNCC 1 cut(s) 19
NmuCI GTSAC 1 cut(s) 136
NsiI ATGCAT 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 152
PspGI CCWGG 1 cut(s) 152
PspN4I GGNNCC 1 cut(s) 19
PsuI RGATCY 1 cut(s) 130
Sau3AI GATC 2 cut(s) 118, 130
ScrFI CCNGG 1 cut(s) 154
SetI ASST 4 cut(s) 84, 111, 126, 155
SgeI CNNG 9 cut(s) 27, 35, 89, 95, 118, 140, 146, 165, 166
Sse9I AATT 2 cut(s) 39, 67
SsiI CCGC 1 cut(s) 26
StyD4I CCNGG 1 cut(s) 152
TasI AATT 2 cut(s) 39, 67
TseFI GTSAC 1 cut(s) 136
Tsp45I GTSAC 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 45
TspGWI ACGGA 1 cut(s) 160
Zsp2I ATGCAT 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.