Rmu_sc0015334.1_g000001
ERF Family

2'-5' RNA ligase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015334.1
Physical Location & Seq
Reverse (-)
1616 .. 1843
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015334.1_g000001.1.cds

Sequence Viewer

Length: 228 bp
atgaagaaagaaggtgtcgaaattggggaggagtatcggactgattcttggatgccttactgtgctgttgctcaagatgtgccgaagagtcggatggctgaagcgttttgcgtattgagggacttgaagttgccggttgctgggtatgctatggatattgggctggtggagttttcgccggtgagggagttgttttcttttgtgctaggtaacacagtagaagcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.41

Weight (kDa)

4.64

Isoelectric Point (pI)

47.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 120
AfiI CCNNNNNNNGG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 127
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 193
BccI CCATC 1 cut(s) 88
BfaI CTAG 1 cut(s) 206
BmsI GCATC 1 cut(s) 42
BpuEI CTTGAG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse118I RCCGGY 2 cut(s) 133, 178
BseGI GGATG 2 cut(s) 57, 99
BseLI CCNNNNNNNGG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 44
BseYI CCCAGC 1 cut(s) 140
BsiSI CCGG 2 cut(s) 134, 179
BslFI GGGAC 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 140
BsmFI GGGAC 1 cut(s) 134
BsrFI RCCGGY 2 cut(s) 133, 178
BssAI RCCGGY 2 cut(s) 133, 178
Bst4CI ACNGT 2 cut(s) 62, 217
Bst6I CTCTTC 1 cut(s) 80
BstF5I GGATG 2 cut(s) 57, 99
BstMWI GCNNNNNNNGC 1 cut(s) 146
BtsCI GGATG 2 cut(s) 57, 99
Cfr10I RCCGGY 2 cut(s) 133, 178
CviJI RGCY 3 cut(s) 98, 163, 224
CviKI_1 RGCY 3 cut(s) 98, 163, 224
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
Eco57I CTGAAG 1 cut(s) 120
FaiI YATR 2 cut(s) 147, 152
FaqI GGGAC 1 cut(s) 134
FokI GGATG 2 cut(s) 64, 106
FspBI CTAG 1 cut(s) 206
GsaI CCCAGC 1 cut(s) 144
HapII CCGG 2 cut(s) 134, 179
HindIII AAGCTT 1 cut(s) 222
HinfI GANTC 2 cut(s) 44, 88
HpaII CCGG 2 cut(s) 134, 179
HphI GGTGA 1 cut(s) 193
Hpy188I TCNGA 2 cut(s) 39, 93
Hpy188III TCNNGA 1 cut(s) 74
HpyAV CCTTC 1 cut(s) 5
HpyCH4III ACNGT 2 cut(s) 62, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
LpnPI CCDG 4 cut(s) 126, 147, 149, 192
LweI GCATC 1 cut(s) 42
MaeI CTAG 1 cut(s) 206
MaeIII GTNAC 1 cut(s) 209
MboII GAAGA 2 cut(s) 16, 97
MluCI AATT 1 cut(s) 21
MlyI GAGTC 1 cut(s) 97
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 3 cut(s) 22, 111, 177
MspI CCGG 2 cut(s) 134, 179
MwoI GCNNNNNNNGC 1 cut(s) 146
PfeI GAWTC 1 cut(s) 44
PleI GAGTC 1 cut(s) 96
PpsI GAGTC 1 cut(s) 96
PspFI CCCAGC 1 cut(s) 140
SchI GAGTC 1 cut(s) 97
SetI ASST 3 cut(s) 16, 211, 226
SfaNI GCATC 1 cut(s) 42
SgeI CNNG 8 cut(s) 60, 86, 136, 146, 153, 176, 191, 218
SgrAI CRCCGGYG 1 cut(s) 178
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 1 cut(s) 21
SspMI CTAG 1 cut(s) 206
TaaI ACNGT 2 cut(s) 62, 217
TaqI TCGA 1 cut(s) 18
TasI AATT 1 cut(s) 21
TfiI GAWTC 1 cut(s) 44
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.