Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017371.1

Orthogroup ID

OG0010760

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 290

Gene Structure 290 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017371.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 183 bp

atggcgacgagggcgggcagtacttcgagtcggactcgggtcgggaggtacgatctgggtcggaccctaggggagggcaatttcgccaaggtcaagtttgcgaggaacatcgagactggtgagaatttcgctattaagattctggacaaagagaaggtcctcaagcacaagatgatcggccag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0006811 GO:0006812 GO:0006813 GO:0006950 GO:0007154 GO:0007165 GO:0007584 GO:0008150 GO:0008152 GO:0009414 GO:0009415 GO:0009536 GO:0009605 GO:0009628 GO:0009987 GO:0009991 GO:0010035 GO:0010107 GO:0010118 GO:0015672 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0030001 GO:0031667 GO:0034220 GO:0035556 GO:0036211 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051179 GO:0051234 GO:0051716 GO:0055085 GO:0065007 GO:0071704 GO:0071804 GO:0071805 GO:0071944 GO:0098655 GO:0098660 GO:0098662 GO:0140096 GO:1901564 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko04068 ko04140 ko04150 ko04151 ko04152 ko04211 ko04213 ko04371 ko04530 ko04710 ko04714 ko04910 ko04920 ko04921 ko04922 ko04931 ko04932 ko05410 ko05418 map04068 map04140 map04150 map04151 map04152 map04211 map04213 map04371 map04530 map04710 map04714 map04910 map04920 map04921 map04922 map04931 map04932 map05410 map05418

Pfam Domains

Protein Families

NAF Pkinase

Protein Analysis

61

Amino Acids

6.8

Weight (kDa)

10.43

Isoelectric Point (pI)

29.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010760)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30270 AT1G30270 AT1G30270
fragaria_vesca	FvH4_3g05110 FvH4_3g05110 FvH4_3g05110
malus_domestica	MD05G1280400.v1.1 MD10G1258700.v1.1
prunus_persica	Prupe.4G085000_v2.0.a1 Prupe.4G085000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0014761
rosa_laevigata	RLG00000032138
rosa_multiflora	Rmu_co8519507.1_g000001 Rmu_sc0017371.1_g000001
rosa_roxburghii	Rroxscaffold_1G00061780 Rroxscaffold_3G00222800
rosa_rugosa	Rorug05G0020500
rosa_samantha	Rh5AG116100 Rh5BG112900
rosa_wichuraiana	Rw5G010020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	14
AcoI	YGGCCR	1 cut(s)	178
AcsI	RAATTY	1 cut(s)	124
AfaI	GTAC	2 cut(s)	22, 50
AfiI	CCNNNNNNNGG	1 cut(s)	73
Alw26I	GTCTC	1 cut(s)	107
Ama87I	CYCGRG	1 cut(s)	36
AoxI	GGCC	1 cut(s)	178
ApoI	RAATTY	1 cut(s)	124
ArsI	GACNNNNNNTTYG	2 cut(s)	141, 173
AspA2I	CCTAGG	1 cut(s)	67
AspS9I	GGNCC	2 cut(s)	63, 157
AsuHPI	GGTGA	1 cut(s)	131
AvaI	CYCGRG	1 cut(s)	36
AvaII	GGWCC	2 cut(s)	63, 157
AvrII	CCTAGG	1 cut(s)	67
BcoDI	GTCTC	1 cut(s)	107
BfaI	CTAG	1 cut(s)	68
BlnI	CCTAGG	1 cut(s)	67
BmcAI	AGTACT	1 cut(s)	22
Bme18I	GGWCC	2 cut(s)	63, 157
BmeT110I	CYCGRG	1 cut(s)	36
BmgT120I	GGNCC	2 cut(s)	63, 157
BmiI	GGNNCC	1 cut(s)	65
BoxI	GACNNNNGTC	1 cut(s)	38
BplI	GAGNNNNNCTC	2 cut(s)	19, 51
BpuEI	CTTGAG	1 cut(s)	146
BsaJI	CCNNGG	2 cut(s)	67, 87
Bsc4I	CCNNNNNNNGG	1 cut(s)	73
Bse1I	ACTGG	1 cut(s)	121
BseDI	CCNNGG	2 cut(s)	67, 87
BseLI	CCNNNNNNNGG	1 cut(s)	73
BseNI	ACTGG	1 cut(s)	121
BshFI	GGCC	1 cut(s)	180
BsiHKCI	CYCGRG	1 cut(s)	36
BslI	CCNNNNNNNGG	1 cut(s)	73
BsmAI	GTCTC	1 cut(s)	107
BsnI	GGCC	1 cut(s)	180
BsoBI	CYCGRG	1 cut(s)	36
Bsp143I	GATC	2 cut(s)	52, 174
BspACI	CCGC	1 cut(s)	14
BspANI	GGCC	1 cut(s)	180
BspLI	GGNNCC	1 cut(s)	65
BsrI	ACTGG	1 cut(s)	121
BssECI	CCNNGG	2 cut(s)	67, 87
BssMI	GATC	2 cut(s)	52, 174
BssT1I	CCWWGG	2 cut(s)	67, 87
BstC8I	GCNNGC	1 cut(s)	16
BstENI	CCTNNNNNAGG	1 cut(s)	71
BstKTI	GATC	2 cut(s)	55, 177
BstMAI	GTCTC	1 cut(s)	107
BstMBI	GATC	2 cut(s)	52, 174
BstMWI	GCNNNNNNNGC	1 cut(s)	11
BstPAI	GACNNNNGTC	1 cut(s)	38
BsuRI	GGCC	1 cut(s)	180
Cac8I	GCNNGC	1 cut(s)	16
Cfr13I	GGNCC	2 cut(s)	63, 157
Csp6I	GTAC	2 cut(s)	21, 49
CviJI	RGCY	1 cut(s)	180
CviKI_1	RGCY	1 cut(s)	180
CviQI	GTAC	2 cut(s)	21, 49
DpnI	GATC	2 cut(s)	54, 176
DpnII	GATC	2 cut(s)	52, 174
EaeI	YGGCCR	1 cut(s)	178
Eco130I	CCWWGG	2 cut(s)	67, 87
Eco47I	GGWCC	2 cut(s)	63, 157
Eco88I	CYCGRG	1 cut(s)	36
EcoNI	CCTNNNNNAGG	1 cut(s)	71
EcoO109I	RGGNCCY	1 cut(s)	157
EcoT14I	CCWWGG	2 cut(s)	67, 87
ErhI	CCWWGG	2 cut(s)	67, 87
FauI	CCCGC	1 cut(s)	7
FspBI	CTAG	1 cut(s)	68
HaeIII	GGCC	1 cut(s)	180
HinfI	GANTC	3 cut(s)	28, 34, 139
HphI	GGTGA	1 cut(s)	131
Hpy188I	TCNGA	2 cut(s)	33, 63
Hpy188III	TCNNGA	3 cut(s)	43, 112, 143
Hpy99I	CGWCG	1 cut(s)	10
HpyAV	CCTTC	1 cut(s)	148
HpyF10VI	GCNNNNNNNGC	1 cut(s)	11
Kzo9I	GATC	2 cut(s)	52, 174
LpnPI	CCDG	3 cut(s)	41, 102, 128
MaeI	CTAG	1 cut(s)	68
MalI	GATC	2 cut(s)	54, 176
MboI	GATC	2 cut(s)	52, 174
MluCI	AATT	2 cut(s)	79, 124
MlyI	GAGTC	2 cut(s)	28, 37
MmeI	TCCRAC	2 cut(s)	11, 41
MnlI	CCTC	5 cut(s)	3, 39, 67, 96, 170
MseI	TTAA	1 cut(s)	135
MwoI	GCNNNNNNNGC	1 cut(s)	11
NdeII	GATC	2 cut(s)	52, 174
NlaIV	GGNNCC	1 cut(s)	65
PcsI	WCGNNNNNNNCGW	1 cut(s)	48
PfeI	GAWTC	1 cut(s)	139
PleI	GAGTC	2 cut(s)	28, 36
PpsI	GAGTC	2 cut(s)	28, 36
PpuMI	RGGWCCY	1 cut(s)	157
PshAI	GACNNNNGTC	1 cut(s)	38
Psp5II	RGGWCCY	1 cut(s)	157
PspN4I	GGNNCC	1 cut(s)	65
PspPI	GGNCC	2 cut(s)	63, 157
PspPPI	RGGWCCY	1 cut(s)	157
RsaI	GTAC	2 cut(s)	22, 50
RsaNI	GTAC	2 cut(s)	21, 49
SaqAI	TTAA	1 cut(s)	135
Sau3AI	GATC	2 cut(s)	52, 174
Sau96I	GGNCC	2 cut(s)	63, 157
ScaI	AGTACT	1 cut(s)	22
SchI	GAGTC	2 cut(s)	28, 37
SetI	ASST	3 cut(s)	50, 93, 159
SinI	GGWCC	2 cut(s)	63, 157
SmlI	CTYRAG	1 cut(s)	161
SmoI	CTYRAG	1 cut(s)	161
Sse9I	AATT	2 cut(s)	79, 124
SsiI	CCGC	1 cut(s)	14
SspMI	CTAG	1 cut(s)	68
StyI	CCWWGG	2 cut(s)	67, 87
TaqI	TCGA	2 cut(s)	26, 111
TasI	AATT	2 cut(s)	79, 124
TatI	WGTACW	1 cut(s)	20
TfiI	GAWTC	1 cut(s)	139
Tru1I	TTAA	1 cut(s)	135
Tru9I	TTAA	1 cut(s)	135
VpaK11BI	GGWCC	2 cut(s)	63, 157
XagI	CCTNNNNNAGG	1 cut(s)	71
XapI	RAATTY	1 cut(s)	124
XmaJI	CCTAGG	1 cut(s)	67
XspI	CTAG	1 cut(s)	68
ZrmI	AGTACT	1 cut(s)	22

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.