Rmu_sc0017888.1_g000001

Translocase of chloroplast

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017888.1
Physical Location & Seq
Forward (+)
1420 .. 5109
3690 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017888.1_g000001.1.cds

Sequence Viewer

Length: 3690 bp
atggaaaatggtgatgggattgtaggtgggtctcagacggtgggtgagaataaggctgaggttgttgaggagagggttgtagaggattctaatggagtcaaggatgatgtggaggaagaggtttttgaggaggcgatagagaccgggactgttggcgacagtcctcgtgcggaggattttgaagaggcgattgaggttctggatgaggctgagaagagcaaggagcaggaggaggaggctgtggagaatggtggggaggaagtagaaaaatcggtgggtggggatagtgttgatgggtttgtggggactagtgttgatgtggaagagactagtgcgtcgaagggattggcagatgaagagatggtgggtagcctagaagatgcggtaaaagatgtctcggaggttggtgctgatggacaagtagcagtttcaacaggtggggatgaggctgaccatgtgaagtgtgagaatcacgattctaaatcaaatggattgacgaatgacgggttgtcggatgcagcaaatgaggtttcagggattggtgcgggtggagaaataccaattttgactgatgtggacgaggttgatgggaatcctgttgaggttgctgagaatgagaagtctgagaaggacgaccaggataacttagttttggaagtagtggccacagatgaaaaattggagaacgaaggtgctaatcttgattctgctcctgcaactgaatttaatatggagaatttgaaggaagctggaaatggtgaggaaataaaggacagtatcttgagtacagagaatctggatgataagactgtggatgtggtagatacttctgttggtgttactttgaagcttgaagatgataagggtgtggaattgcaagagagaaatatggatccagagcatacagaatgtgagagtactgactcaaataatgctatatttgtcactgaagcaaggcaagtggataataaagttgaagaactgagagctactatgacttgtacggatgcaggagatcaagattcaacggaagtgaaaagtgtttcttctgggcttggtttggagcatgatgtggaaacatctgaacttagaggcatttcatctgaacaacagttgtcaggggtagaaagtcctgtagcatctgaaatggcaggctcagctgtttctaaaagttctgcacctgaggacacagagaagattcaggttggtagcactgtttcgagatcagagaatatcaaagacgatgaacctcagccagctgatgaggttactcatgtagtttgcaacaatggtgctgtgcctgaggagcctgaaaagaaagaaaacaatcatgtagagaagagtagcaacagaatgaatagagtgcaggaggtccagcatgcaccagctcatggtacctctggaaattctacaaatccaactccccttcccgctcgtccagctggccttgggcgtgctgccccccttttggaacatgcacctagggcggtacagcagcctcgggtaaatggtaccgtaactcatgtgcaaaaccagcaaattgaggatcccgttaatggagaggcagaggagtcggatgagactcgtgaaaagcttcagatgatcagagtaaaatttttgcggctttcgcataggcttgggcagactccacataatgttgttgtggcccaggtcttgtacagactggggttagctgagcagctgcatgggagaagtgggggtcgtgttggtgcctttagtttcgaccgtgcgagtgctatgccggagcagctaaagggaactgggaatgaaccccttgatttctcttgtacaattatggttcttggaaagtcaggagttggtaaaagtgccaccatcaattctatatttgatgaagtgaagttcaatactgatgcttttcagatggggacaaagaaggttcaggatgtcgtgggtactgtgcaggggattaaggtaagagtcatcgacacacctgggcttctaccttcctggtcggaccagcgtcagaatgagaaaattctgctcgctgctaagcgctttatcaagaaaacacctccagatattgttttgtatcttgataggttggacatgcagagcagggatttcagtgacatgccactcttgcgcacaatcacagagatttttggggcgactatatggttcaatgcaattgtggttctaactcatgctgcatcagctccgcctgagggcccaaatggcgctgcttctagttatgacatgttcgtcactcaacgatctcatgttgtccagcaagccattcgtcaggcggctggggatatgcgccttatgaatcctgtttccttagtagagaaccactctgcttgcaggaccaatcgggctggccagagagtcttgccaaatggtcaggtttggaagcctcatttgttattgctctcttttgcatccaagatccttgctgaagctaatgcactattgaagttgcaagacagtcctcctggaagaccttttgcacctcgatctaggccacctccattacctttccttctttcctccctccttcagtcaaaaccgcagttgaagctgcctgaggatcaatttggtgatgatgatgatggcgtagatgatgatctggatgagtcttcagattcggaagatgaatcagaatttgatgaattaccaccattcaaacgtttgactaaggcccaggtggagaaactctctaaagctcagaaaaaggcatatttcgatgagttggagtatagagaaaagctttttatgaagaaacagttgaaggacgagaaaaagcgacgaaagttgatgaaaaaaatggcagctgcagcaaaggatctgccaagtgattatggtgaaactgtagaggaagaaagtgcaagtgcagcgtctgtacccgttcccatgccagatttgcccttgcctgcttcctttgattctgataatcccactcatcgttatcgatatctagattcttccaaccagtggcttgtaagacctgttctagaaactcatggttgggatcatgacgttggttatgagggcataaatgcagaaagattgtttgtcttaaatggcaaaatacccttatcattttctggccaggtcaccaaagataagaaggatgccaatgtccaaatggaactagctagttcagtcaagcatggggaagggaaggcaagttcggtaggacttgaaatgcagactgttggaaaggacttggcttatactctacgaggcgacactaggttcagtaattttaggacgaataaagcaagtgctggtgtctcggtcaccctcttgggtgatgctctatcagctgggttgaaaattgaagacaaatttattcctcataaacggttccggttggttatgacgggtggtgcaatgactgctcgtggggacattgcttatggtggtagtttggaggctcagttaagagacaaagatcatccgctgggtcgttcactatcaacttttgggctctctgtgatggattggcatggagatcttgctattggaggtaatatacagactcagattccagttggtcgacatacaaaccttataggtcgtgccaatttaaataataggggagcaggacaactgagcatccgcttaaatagttctgaacagcttcaaatagctttgattggtctcattccgctgcttagaaagttgttcacttaccctgaatag

Protein Analysis

1229

Amino Acids

133.41

Weight (kDa)

4.69

Isoelectric Point (pI)

37.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 334, 2243
Acc16I TGCGCA 1 cut(s) 2126
Acc65I GGTACC 2 cut(s) 1394, 1511
AccB1I GGYRCC 3 cut(s) 1394, 1511, 1730
AccB7I CCANNNNNTGG 2 cut(s) 1391, 2976
AccBSI CCGCTC 1 cut(s) 1433
AccI GTMKAC 1 cut(s) 3544
AclI AACGTT 1 cut(s) 2671
AclWI GGATC 8 cut(s) 887, 900, 1541, 1554, 2425, 2580, 2835, 3021
AcoI YGGCCR 3 cut(s) 663, 2362, 3091
AcsI RAATTY 7 cut(s) 722, 736, 1405, 1613, 2016, 2645, 3332
AcuI CTGAAG 5 cut(s) 969, 1580, 2460, 2525, 2607
AfeI AGCGCT 1 cut(s) 2036
AfiI CCNNNNNNNGG 5 cut(s) 1391, 1468, 1556, 2207, 2976
AflIII ACRYGT 1 cut(s) 2238
AhdI GACNNNNNGTC 1 cut(s) 508
AhlI ACTAGT 2 cut(s) 308, 329
AjnI CCWGG 7 cut(s) 636, 1668, 1972, 1988, 2476, 2685, 3093
AloI GAACNNNNNNTCC 2 cut(s) 3157, 3189
Alw26I GTCTC 8 cut(s) 36, 134, 320, 400, 1574, 3283, 3426, 3653
AlwI GGATC 8 cut(s) 887, 900, 1541, 1554, 2425, 2580, 2835, 3021
AlwNI CAGNNNCTG 1 cut(s) 2882
Ama87I CYCGRG 1 cut(s) 1500
Aor51HI AGCGCT 1 cut(s) 2036
AoxI GGCC 8 cut(s) 663, 1444, 1665, 2209, 2362, 2504, 2682, 3091
ApaI GGGCCC 1 cut(s) 2213
ApoI RAATTY 7 cut(s) 722, 736, 1405, 1613, 2016, 2645, 3332
Asp700I GAANNNNTTC 2 cut(s) 1593, 3627
Asp718I GGTACC 2 cut(s) 1394, 1511
AspA2I CCTAGG 1 cut(s) 1481
AspLEI GCGC 4 cut(s) 2037, 2127, 2222, 2304
AspS9I GGNCC 7 cut(s) 1372, 1666, 1996, 2209, 2210, 2349, 2683
AsuC2I CCSGG 1 cut(s) 145
AsuHPI GGTGA 8 cut(s) 23, 56, 770, 2594, 2858, 3091, 3277, 3308
AvaI CYCGRG 1 cut(s) 1500
AvaII GGWCC 3 cut(s) 1372, 1996, 2349
AvrII CCTAGG 1 cut(s) 1481
AxyI CCTNAGG 4 cut(s) 1182, 1302, 2205, 2568
BaeGI GKGCMC 1 cut(s) 2213
BaeI ACNNNNGTAYC 2 cut(s) 816, 849
BalI TGGCCA 3 cut(s) 665, 2364, 3093
BamHI GGATCC 2 cut(s) 892, 1546
BanI GGYRCC 3 cut(s) 1394, 1511, 1730
BanII GRGCYC 2 cut(s) 2213, 3477
BauI CACGAG 3 cut(s) 165, 1584, 3387
BbsI GAAGAC 3 cut(s) 2488, 2613, 3333
BbvCI CCTCAGC 2 cut(s) 57, 1251
BccI CCATC 9 cut(s) 8, 287, 355, 407, 581, 1862, 1897, 2588, 3478
BcgI CGANNNNNNTGC 6 cut(s) 1554, 1588, 1741, 1775, 2261, 2295
BciT130I CCWGG 7 cut(s) 638, 1670, 1974, 1990, 2478, 2687, 3095
BclI TGATCA 1 cut(s) 1602
BcnI CCSGG 1 cut(s) 145
BcoDI GTCTC 8 cut(s) 36, 134, 320, 400, 1574, 3283, 3426, 3653
BcuI ACTAGT 2 cut(s) 308, 329
BfmI CTRYAG 3 cut(s) 1134, 2817, 2853
BfoI RGCGCY 2 cut(s) 2038, 2223
BglI GCCNNNNNGGC 1 cut(s) 2217
BglII AGATCT 1 cut(s) 3499
BlnI CCTAGG 1 cut(s) 1481
BlpI GCTNAGC 3 cut(s) 1156, 1695, 2031
BmcAI AGTACT 1 cut(s) 919
Bme1390I CCNGG 8 cut(s) 145, 638, 1670, 1974, 1990, 2478, 2687, 3095
Bme18I GGWCC 3 cut(s) 1372, 1996, 2349
BmeRI GACNNNNNGTC 1 cut(s) 508
BmeT110I CYCGRG 1 cut(s) 1500
BmgT120I GGNCC 7 cut(s) 1372, 1666, 1996, 2209, 2210, 2349, 2683
BmiI GGNNCC 8 cut(s) 894, 1308, 1396, 1513, 1548, 1732, 2211, 3353
BmrFI CCNGG 8 cut(s) 145, 638, 1670, 1974, 1990, 2478, 2687, 3095
BmrI ACTGGG 2 cut(s) 1694, 1791
BmuI ACTGGG 2 cut(s) 1694, 1791
BoxI GACNNNNGTC 1 cut(s) 2001
BpiI GAAGAC 3 cut(s) 2488, 2613, 3333
BplI GAGNNNNNCTC 4 cut(s) 2321, 2353, 2684, 2716
BpmI CTGGAG 1 cut(s) 2040
Bpu10I CCTNAGC 2 cut(s) 57, 1251
Bpu1102I GCTNAGC 3 cut(s) 1156, 1695, 2031
BpuEI CTTGAG 1 cut(s) 802
BpuMI CCSGG 1 cut(s) 145
Bsa29I ATCGAT 1 cut(s) 2953
BsaBI GATNNNNATC 2 cut(s) 591, 2607
BsaI GGTCTC 3 cut(s) 36, 134, 3653
BsaJI CCNNGG 6 cut(s) 1447, 1481, 1499, 1668, 1973, 2685
BsaWI WCCGGW 1 cut(s) 3354
BsaXI ACNNNNNCTCC 2 cut(s) 3410, 3440
Bsc4I CCNNNNNNNGG 5 cut(s) 1391, 1468, 1556, 2207, 2976
Bse1I ACTGG 4 cut(s) 1689, 1786, 2974, 3536
Bse21I CCTNAGG 4 cut(s) 1182, 1302, 2205, 2568
Bse3DI GCAATG 2 cut(s) 3384, 3396
Bse8I GATNNNNATC 2 cut(s) 591, 2607
BseBI CCWGG 7 cut(s) 638, 1670, 1974, 1990, 2478, 2687, 3095
BseCI ATCGAT 1 cut(s) 2953
BseDI CCNNGG 6 cut(s) 1447, 1481, 1499, 1668, 1973, 2685
BseJI GATNNNNATC 2 cut(s) 591, 2607
BseLI CCNNNNNNNGG 5 cut(s) 1391, 1468, 1556, 2207, 2976
BseMI GCAATG 2 cut(s) 3384, 3396
BseNI ACTGG 4 cut(s) 1689, 1786, 2974, 3536
BseRI GAGGAG 6 cut(s) 83, 143, 245, 248, 1319, 1583
BseSI GKGCMC 1 cut(s) 2213
BseYI CCCAGC 3 cut(s) 2291, 3311, 3448
BsgI GTGCAG 4 cut(s) 1161, 1385, 1961, 2895
Bsh1285I CGRYCG 1 cut(s) 1747
BshFI GGCC 8 cut(s) 665, 1446, 1667, 2211, 2364, 2506, 2684, 3093
BshNI GGYRCC 3 cut(s) 1394, 1511, 1730
BshVI ATCGAT 1 cut(s) 2953
BsiEI CGRYCG 1 cut(s) 1747
BsiHKCI CYCGRG 1 cut(s) 1500
BsiSI CCGG 3 cut(s) 144, 1763, 3355
BslFI GGGAC 4 cut(s) 160, 319, 1921, 3407
BslI CCNNNNNNNGG 5 cut(s) 1391, 1468, 1556, 2207, 2976
BsmAI GTCTC 8 cut(s) 36, 134, 320, 400, 1574, 3283, 3426, 3653
BsmFI GGGAC 4 cut(s) 160, 319, 1921, 3407
BsnI GGCC 8 cut(s) 665, 1446, 1667, 2211, 2364, 2506, 2684, 3093
Bso31I GGTCTC 3 cut(s) 36, 134, 3653
BsoBI CYCGRG 1 cut(s) 1500
Bsp120I GGGCCC 1 cut(s) 2209
Bsp1286I GDGCHC 2 cut(s) 2213, 3477
Bsp1407I TGTACA 2 cut(s) 1677, 1808
Bsp1720I GCTNAGC 3 cut(s) 1156, 1695, 2031
BspANI GGCC 8 cut(s) 665, 1446, 1667, 2211, 2364, 2506, 2684, 3093
BspDI ATCGAT 1 cut(s) 2953
BspHI TCATGA 1 cut(s) 3016
BspLI GGNNCC 8 cut(s) 894, 1308, 1396, 1513, 1548, 1732, 2211, 3353
BspMAI CTGCAG 1 cut(s) 2821
BspPI GGATC 8 cut(s) 887, 900, 1541, 1554, 2425, 2580, 2835, 3021
BspQI GCTCTTC 1 cut(s) 209
BspT107I GGYRCC 3 cut(s) 1394, 1511, 1730
BspTNI GGTCTC 3 cut(s) 36, 134, 3653
BsrBI CCGCTC 1 cut(s) 1433
BsrDI GCAATG 2 cut(s) 3384, 3396
BsrGI TGTACA 2 cut(s) 1677, 1808
BsrI ACTGG 4 cut(s) 1689, 1786, 2974, 3536
BssECI CCNNGG 6 cut(s) 1447, 1481, 1499, 1668, 1973, 2685
BssSI CACGAG 3 cut(s) 165, 1584, 3387
BssT1I CCWWGG 2 cut(s) 1447, 1481
Bst2BI CACGAG 3 cut(s) 165, 1584, 3387
Bst2UI CCWGG 7 cut(s) 638, 1670, 1974, 1990, 2478, 2687, 3095
Bst6I CTCTTC 6 cut(s) 111, 177, 209, 318, 351, 1334
BstAPI GCANNNNNTGC 1 cut(s) 3383
BstAUI TGTACA 2 cut(s) 1677, 1808
BstEII GGTNACC 2 cut(s) 3097, 3283
BstH2I RGCGCY 2 cut(s) 2038, 2223
BstHHI GCGC 4 cut(s) 2037, 2127, 2222, 2304
BstMAI GTCTC 8 cut(s) 36, 134, 320, 400, 1574, 3283, 3426, 3653
BstMCI CGRYCG 1 cut(s) 1747
BstNI CCWGG 7 cut(s) 638, 1670, 1974, 1990, 2478, 2687, 3095
BstNSI RCATGY 5 cut(s) 1382, 1478, 2092, 2116, 2242
BstPAI GACNNNNGTC 1 cut(s) 2001
BstPI GGTNACC 2 cut(s) 3097, 3283
BstSCI CCNGG 8 cut(s) 143, 636, 1668, 1972, 1988, 2476, 2685, 3093
BstSFI CTRYAG 3 cut(s) 1134, 2817, 2853
BstSLI GKGCMC 1 cut(s) 2213
BstV2I GAAGAC 3 cut(s) 2488, 2613, 3333
BstX2I RGATCY 5 cut(s) 892, 1546, 2430, 2827, 3499
BstYI RGATCY 5 cut(s) 892, 1546, 2430, 2827, 3499
Bsu15I ATCGAT 1 cut(s) 2953
Bsu36I CCTNAGG 4 cut(s) 1182, 1302, 2205, 2568
BsuRI GGCC 8 cut(s) 665, 1446, 1667, 2211, 2364, 2506, 2684, 3093
BsuTUI ATCGAT 1 cut(s) 2953
BtsIMutI CAGTG 4 cut(s) 945, 1212, 2113, 2981
CaiI CAGNNNCTG 1 cut(s) 2882
CciI TCATGA 1 cut(s) 3016
CfoI GCGC 4 cut(s) 2037, 2127, 2222, 2304
Cfr13I GGNCC 7 cut(s) 1372, 1666, 1996, 2209, 2210, 2349, 2683
ClaI ATCGAT 1 cut(s) 2953
CseI GACGC 3 cut(s) 324, 1991, 2868
CspCI CAANNNNNGTGG 4 cut(s) 942, 977, 2324, 2359
DraI TTTAAA 1 cut(s) 3576
DrdI GACNNNNNNGTC 2 cut(s) 334, 2243
DriI GACNNNNNGTC 1 cut(s) 508
DseDI GACNNNNNNGTC 2 cut(s) 334, 2243
EaeI YGGCCR 3 cut(s) 663, 2362, 3091
Eam1104I CTCTTC 6 cut(s) 111, 177, 209, 318, 351, 1334
Eam1105I GACNNNNNGTC 1 cut(s) 508
EarI CTCTTC 6 cut(s) 111, 177, 209, 318, 351, 1334
EciI GGCGGA 1 cut(s) 2190
Eco130I CCWWGG 2 cut(s) 1447, 1481
Eco24I GRGCYC 2 cut(s) 2213, 3477
Eco31I GGTCTC 3 cut(s) 36, 134, 3653
Eco32I GATATC 1 cut(s) 2957
Eco47I GGWCC 3 cut(s) 1372, 1996, 2349
Eco47III AGCGCT 1 cut(s) 2036
Eco57I CTGAAG 5 cut(s) 969, 1580, 2460, 2525, 2607
Eco81I CCTNAGG 4 cut(s) 1182, 1302, 2205, 2568
Eco88I CYCGRG 1 cut(s) 1500
Eco91I GGTNACC 2 cut(s) 3097, 3283
EcoO109I RGGNCCY 1 cut(s) 2209
EcoO65I GGTNACC 2 cut(s) 3097, 3283
EcoRII CCWGG 7 cut(s) 636, 1668, 1972, 1988, 2476, 2685, 3093
EcoRV GATATC 1 cut(s) 2957
EcoT14I CCWWGG 2 cut(s) 1447, 1481
EcoT38I GRGCYC 2 cut(s) 2213, 3477
ErhI CCWWGG 2 cut(s) 1447, 1481
FalI AAGNNNNNCTT 2 cut(s) 1030, 1062
FaqI GGGAC 4 cut(s) 160, 319, 1921, 3407
FauI CCCGC 2 cut(s) 538, 1438
FbaI TGATCA 1 cut(s) 1602
FblI GTMKAC 1 cut(s) 3544
FriOI GRGCYC 2 cut(s) 2213, 3477
FspI TGCGCA 1 cut(s) 2126
GlaI GCGC 4 cut(s) 2036, 2126, 2221, 2303
GsaI CCCAGC 3 cut(s) 2295, 3315, 3452
GsuI CTGGAG 1 cut(s) 2040
HaeII RGCGCY 2 cut(s) 2038, 2223
HaeIII GGCC 8 cut(s) 665, 1446, 1667, 2211, 2364, 2506, 2684, 3093
HapII CCGG 3 cut(s) 144, 1763, 3355
HgaI GACGC 3 cut(s) 324, 1991, 2868
HhaI GCGC 4 cut(s) 2037, 2127, 2222, 2304
Hin6I GCGC 4 cut(s) 2035, 2125, 2220, 2302
HinP1I GCGC 4 cut(s) 2035, 2125, 2220, 2302
HincII GTYRAC 1 cut(s) 3545
HindII GTYRAC 1 cut(s) 3545
HindIII AAGCTT 3 cut(s) 848, 1592, 2750
HpaII CCGG 3 cut(s) 144, 1763, 3355
HphI GGTGA 8 cut(s) 23, 56, 770, 2594, 2858, 3091, 3277, 3308
Hpy166II GTNNAC 4 cut(s) 577, 3458, 3545, 3675
Hpy8I GTNNAC 4 cut(s) 577, 3458, 3545, 3675
Hpy99I CGWCG 2 cut(s) 340, 2793
HpyCH4IV ACGT 2 cut(s) 2671, 3021
HpySE526I ACGT 2 cut(s) 2671, 3021
HspAI GCGC 4 cut(s) 2035, 2125, 2220, 2302
KpnI GGTACC 2 cut(s) 1398, 1515
Ksp22I TGATCA 1 cut(s) 1602
LguI GCTCTTC 1 cut(s) 209
LmnI GCTCC 7 cut(s) 223, 715, 1063, 1306, 1765, 2203, 3587
MaeII ACGT 2 cut(s) 2671, 3021
MaeIII GTNAC 8 cut(s) 838, 943, 1267, 1516, 2108, 2245, 3097, 3283
MbiI CCGCTC 1 cut(s) 1433
MfeI CAATTG 1 cut(s) 2169
MflI RGATCY 5 cut(s) 892, 1546, 2430, 2827, 3499
MhlI GDGCHC 2 cut(s) 2213, 3477
MlsI TGGCCA 3 cut(s) 665, 2364, 3093
MluNI TGGCCA 3 cut(s) 665, 2364, 3093
MlyI GAGTC 9 cut(s) 105, 917, 1576, 1580, 1639, 1968, 2379, 2627, 3520
MmeI TCCRAC 8 cut(s) 492, 1442, 1554, 1974, 2064, 2715, 2994, 3181
Mox20I TGGCCA 3 cut(s) 665, 2364, 3093
MroXI GAANNNNTTC 2 cut(s) 1593, 3627
MscI TGGCCA 3 cut(s) 665, 2364, 3093
MseI TTAA 7 cut(s) 726, 1554, 1950, 3062, 3428, 3575, 3611
Msp20I TGGCCA 3 cut(s) 665, 2364, 3093
MspA1I CMGCKG 8 cut(s) 1160, 1259, 1442, 1702, 2816, 3311, 3448, 3658
MspI CCGG 3 cut(s) 144, 1763, 3355
MspR9I CCNGG 8 cut(s) 145, 638, 1670, 1974, 1990, 2478, 2687, 3095
MunI CAATTG 1 cut(s) 2169
MvaI CCWGG 7 cut(s) 638, 1670, 1974, 1990, 2478, 2687, 3095
NciI CCSGG 1 cut(s) 145
NlaIV GGNNCC 8 cut(s) 894, 1308, 1396, 1513, 1548, 1732, 2211, 3353
NmuCI GTSAC 5 cut(s) 943, 2108, 2245, 3097, 3283
NsbI TGCGCA 1 cut(s) 2126
NspI RCATGY 5 cut(s) 1382, 1478, 2092, 2116, 2242
PaeI GCATGC 1 cut(s) 1382
PagI TCATGA 1 cut(s) 3016
PciI ACATGT 1 cut(s) 2238
PciSI GCTCTTC 1 cut(s) 209
PdmI GAANNNNTTC 2 cut(s) 1593, 3627
PflMI CCANNNNNTGG 2 cut(s) 1391, 2976
PfoI TCCNGGA 1 cut(s) 2476
PleI GAGTC 9 cut(s) 104, 917, 1576, 1579, 1639, 1967, 2378, 2626, 3520
PpsI GAGTC 9 cut(s) 104, 917, 1576, 1579, 1639, 1967, 2378, 2626, 3520
PscI ACATGT 1 cut(s) 2238
PshAI GACNNNNGTC 1 cut(s) 2001
Psp1406I AACGTT 1 cut(s) 2671
Psp6I CCWGG 7 cut(s) 636, 1668, 1972, 1988, 2476, 2685, 3093
PspEI GGTNACC 2 cut(s) 3097, 3283
PspFI CCCAGC 3 cut(s) 2291, 3311, 3448
PspGI CCWGG 7 cut(s) 636, 1668, 1972, 1988, 2476, 2685, 3093
PspN4I GGNNCC 8 cut(s) 894, 1308, 1396, 1513, 1548, 1732, 2211, 3353
PspOMI GGGCCC 1 cut(s) 2209
PspPI GGNCC 7 cut(s) 1372, 1666, 1996, 2209, 2210, 2349, 2683
PsrI GAACNNNNNNTAC 2 cut(s) 2976, 3008
PstI CTGCAG 1 cut(s) 2821
PstNI CAGNNNCTG 1 cut(s) 2882
PsuI RGATCY 5 cut(s) 892, 1546, 2430, 2827, 3499
PvuII CAGCTG 6 cut(s) 1160, 1259, 1442, 1702, 2816, 3311
SalI GTCGAC 1 cut(s) 3543
SapI GCTCTTC 1 cut(s) 209
SaqAI TTAA 7 cut(s) 726, 1554, 1950, 3062, 3428, 3575, 3611
Sau96I GGNCC 7 cut(s) 1372, 1666, 1996, 2209, 2210, 2349, 2683
ScaI AGTACT 1 cut(s) 919
SchI GAGTC 9 cut(s) 105, 917, 1576, 1580, 1639, 1968, 2379, 2627, 3520
ScrFI CCNGG 8 cut(s) 145, 638, 1670, 1974, 1990, 2478, 2687, 3095
SduI GDGCHC 2 cut(s) 2213, 3477
SfcI CTRYAG 3 cut(s) 1134, 2817, 2853
SinI GGWCC 3 cut(s) 1372, 1996, 2349
SmiI ATTTAAAT 1 cut(s) 3576
SmlI CTYRAG 1 cut(s) 781
SmoI CTYRAG 1 cut(s) 781
SpeI ACTAGT 2 cut(s) 308, 329
SphI GCATGC 1 cut(s) 1382
StyD4I CCNGG 8 cut(s) 143, 636, 1668, 1972, 1988, 2476, 2685, 3093
StyI CCWWGG 2 cut(s) 1447, 1481
SwaI ATTTAAAT 1 cut(s) 3576
TaiI ACGT 2 cut(s) 2674, 3024
TaqI TCGA 8 cut(s) 338, 1220, 1743, 1965, 2497, 2727, 2953, 3544
TaqII GACCGA 1 cut(s) 3271
TatI WGTACW 4 cut(s) 785, 917, 1677, 1808
TauI GCSGC 2 cut(s) 1624, 2291
Tru1I TTAA 7 cut(s) 726, 1554, 1950, 3062, 3428, 3575, 3611
Tru9I TTAA 7 cut(s) 726, 1554, 1950, 3062, 3428, 3575, 3611
TscAI CASTG 4 cut(s) 952, 1219, 2113, 2981
TseFI GTSAC 5 cut(s) 943, 2108, 2245, 3097, 3283
Tsp45I GTSAC 5 cut(s) 943, 2108, 2245, 3097, 3283
TspGWI ACGGA 2 cut(s) 1019, 1043
TspRI CASTG 4 cut(s) 952, 1219, 2113, 2981
Van91I CCANNNNNTGG 2 cut(s) 1391, 2976
VpaK11BI GGWCC 3 cut(s) 1372, 1996, 2349
XapI RAATTY 7 cut(s) 722, 736, 1405, 1613, 2016, 2645, 3332
XbaI TCTAGA 2 cut(s) 2959, 2995
XceI RCATGY 5 cut(s) 1382, 1478, 2092, 2116, 2242
XcmI CCANNNNNNNNNTGG 1 cut(s) 3127
XmaJI CCTAGG 1 cut(s) 1481
XmiI GTMKAC 1 cut(s) 3544
XmnI GAANNNNTTC 2 cut(s) 1593, 3627
ZrmI AGTACT 1 cut(s) 919
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.