Rmu_sc0017953.1_g000002

Amino acid transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017953.1
Physical Location & Seq
Forward (+)
1135 .. 1938
804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017953.1_g000002.1.cds

Sequence Viewer

Length: 804 bp
atgagtccgaaaagcttgtatgtttgggggtgttttccatttcaattggggttgaattcgattcccacactgacccatttggctcctttgagtatttttgctgatgtggttgatcttggagctatgggagttgttatggttgaggatgtaatgatttttctgcagaatcggcctgctttgcaagcatttgggggcttttcggttttcttctatggtcttggtgtggctgtttatgcatttgaagggattgggatgatattgccattggaatctgaggccagagacaaggacaagtttggcagagtgttggctttggttatggccttcattgctttgttgtatggaagctttggggttctgggttactttgcttttggggaagagactaaagacataatcactaccaactttgggcaaggcttggtgagcactctagtccagttgggtctctgcataaacttgttctttactctaccattgatgatgaacccggttttcgaggttgtggagaggaggttttgggatggggggtactgcttgtggctgaggtgggttatggtgtttggggtctgcttggtggctcttacagtgcctaattttgcagactttttgtcactggtggggagcagtgtttgtgtggctttagggtttgtgtttcctgctttgttccatttgatggtgttcaaggaagagttggggtggcatgggatggttttggatgggactattgtggttattggggtgattattggagtctctggaacttggtcttcgatagcagagattgttgcacccaaagcttga

Protein Analysis

267

Amino Acids

29.13

Weight (kDa)

4.76

Isoelectric Point (pI)

33.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 676
AcsI RAATTY 1 cut(s) 55
AfaI GTAC 1 cut(s) 533
AfiI CCNNNNNNNGG 2 cut(s) 411, 676
AgsI TTSAA 4 cut(s) 44, 55, 242, 685
AhdI GACNNNNNGTC 1 cut(s) 610
AluBI AGCT 4 cut(s) 15, 122, 348, 800
AluI AGCT 4 cut(s) 15, 122, 348, 800
Alw21I GWGCWC 1 cut(s) 431
Alw26I GTCTC 4 cut(s) 276, 377, 452, 760
AoxI GGCC 3 cut(s) 170, 276, 321
ApoI RAATTY 1 cut(s) 55
AsuC2I CCSGG 1 cut(s) 491
AsuHPI GGTGA 2 cut(s) 436, 754
BbsI GAAGAC 1 cut(s) 762
Bbv12I GWGCWC 1 cut(s) 431
BbvCI CCTCAGC 1 cut(s) 545
BccI CCATC 4 cut(s) 518, 670, 703, 713
BcnI CCSGG 1 cut(s) 491
BcoDI GTCTC 4 cut(s) 276, 377, 452, 760
BfaI CTAG 1 cut(s) 434
BfmI CTRYAG 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 491
BmeRI GACNNNNNGTC 1 cut(s) 610
BmiI GGNNCC 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 491
BpiI GAAGAC 1 cut(s) 762
Bpu10I CCTNAGC 1 cut(s) 545
BpuMI CCSGG 1 cut(s) 491
BsaI GGTCTC 1 cut(s) 452
BsaXI ACNNNNNCTCC 2 cut(s) 500, 530
Bsc4I CCNNNNNNNGG 2 cut(s) 411, 676
Bse1I ACTGG 2 cut(s) 439, 621
Bse3DI GCAATG 1 cut(s) 327
BseGI GGATG 5 cut(s) 151, 258, 529, 714, 724
BseLI CCNNNNNNNGG 2 cut(s) 411, 676
BseMI GCAATG 1 cut(s) 327
BseMII CTCAG 2 cut(s) 264, 536
BseNI ACTGG 2 cut(s) 439, 621
BseRI GAGGAG 1 cut(s) 526
BshFI GGCC 3 cut(s) 172, 278, 323
BsiHKAI GWGCWC 1 cut(s) 431
BsiSI CCGG 1 cut(s) 491
BslFI GGGAC 1 cut(s) 736
BslI CCNNNNNNNGG 2 cut(s) 411, 676
BsmAI GTCTC 4 cut(s) 276, 377, 452, 760
BsmFI GGGAC 1 cut(s) 736
BsnI GGCC 3 cut(s) 172, 278, 323
Bso31I GGTCTC 1 cut(s) 452
Bsp1286I GDGCHC 1 cut(s) 431
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 3 cut(s) 172, 278, 323
BspCNI CTCAG 2 cut(s) 265, 537
BspLI GGNNCC 1 cut(s) 84
BspMAI CTGCAG 1 cut(s) 165
BspTNI GGTCTC 1 cut(s) 452
BsrDI GCAATG 1 cut(s) 327
BsrI ACTGG 2 cut(s) 439, 621
BssMI GATC 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 589
Bst6I CTCTTC 2 cut(s) 375, 684
BstC8I GCNNGC 2 cut(s) 174, 183
BstDEI CTNAG 2 cut(s) 273, 545
BstF5I GGATG 5 cut(s) 151, 258, 529, 714, 724
BstKTI GATC 1 cut(s) 115
BstMAI GTCTC 4 cut(s) 276, 377, 452, 760
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 7 cut(s) 169, 178, 182, 233, 329, 426, 797
BstSCI CCNGG 1 cut(s) 489
BstSFI CTRYAG 1 cut(s) 161
BstV2I GAAGAC 1 cut(s) 762
BsuRI GGCC 3 cut(s) 172, 278, 323
BtsCI GGATG 5 cut(s) 151, 258, 529, 714, 724
BtsI GCAGTG 1 cut(s) 634
BtsIMutI CAGTG 4 cut(s) 68, 594, 614, 634
Cac8I GCNNGC 2 cut(s) 174, 183
Csp6I GTAC 1 cut(s) 532
CviAII CATG 1 cut(s) 704
CviQI GTAC 1 cut(s) 532
DdeI CTNAG 2 cut(s) 273, 545
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
DriI GACNNNNNGTC 1 cut(s) 610
Eam1104I CTCTTC 2 cut(s) 375, 684
Eam1105I GACNNNNNGTC 1 cut(s) 610
EarI CTCTTC 2 cut(s) 375, 684
Eco31I GGTCTC 1 cut(s) 452
EcoRI GAATTC 1 cut(s) 55
EcoT22I ATGCAT 1 cut(s) 238
FaeI CATG 1 cut(s) 707
FaqI GGGAC 1 cut(s) 736
FatI CATG 1 cut(s) 703
FokI GGATG 5 cut(s) 158, 265, 536, 721, 731
FspBI CTAG 1 cut(s) 434
HaeIII GGCC 3 cut(s) 172, 278, 323
HapII CCGG 1 cut(s) 491
Hin1II CATG 1 cut(s) 707
HindIII AAGCTT 3 cut(s) 13, 346, 798
HinfI GANTC 5 cut(s) 4, 61, 166, 269, 753
HpaII CCGG 1 cut(s) 491
HphI GGTGA 2 cut(s) 436, 754
Hpy188I TCNGA 2 cut(s) 9, 274
Hpy188III TCNNGA 1 cut(s) 759
HpyAV CCTTC 2 cut(s) 236, 334
HpyCH4III ACNGT 1 cut(s) 589
HpyCH4V TGCA 6 cut(s) 163, 181, 236, 453, 602, 791
HpyF10VI GCNNNNNNNGC 7 cut(s) 169, 178, 182, 233, 329, 426, 797
HpyF3I CTNAG 2 cut(s) 273, 545
Hsp92II CATG 1 cut(s) 707
Kzo9I GATC 1 cut(s) 112
LmnI GCTCC 3 cut(s) 88, 119, 624
LpnPI CCDG 8 cut(s) 186, 292, 344, 452, 504, 602, 672, 744
MaeI CTAG 1 cut(s) 434
MaeIII GTNAC 2 cut(s) 362, 612
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 4 cut(s) 199, 392, 701, 762
MfeI CAATTG 1 cut(s) 44
MhlI GDGCHC 1 cut(s) 431
MluCI AATT 3 cut(s) 44, 55, 595
MlyI GAGTC 2 cut(s) 13, 762
MnlI CCTC 6 cut(s) 136, 268, 493, 504, 507, 540
Mph1103I ATGCAT 1 cut(s) 238
MspI CCGG 1 cut(s) 491
MspR9I CCNGG 1 cut(s) 491
MunI CAATTG 1 cut(s) 44
MwoI GCNNNNNNNGC 7 cut(s) 169, 178, 182, 233, 329, 426, 797
NciI CCSGG 1 cut(s) 491
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 707
NlaIV GGNNCC 1 cut(s) 84
NmuCI GTSAC 1 cut(s) 612
NsiI ATGCAT 1 cut(s) 238
PfeI GAWTC 3 cut(s) 61, 166, 269
PflMI CCANNNNNTGG 1 cut(s) 676
PleI GAGTC 2 cut(s) 12, 761
PpsI GAGTC 2 cut(s) 12, 761
PspN4I GGNNCC 1 cut(s) 84
PstI CTGCAG 1 cut(s) 165
RsaI GTAC 1 cut(s) 533
RsaNI GTAC 1 cut(s) 532
Sau3AI GATC 1 cut(s) 112
SchI GAGTC 2 cut(s) 13, 762
ScrFI CCNGG 1 cut(s) 491
SduI GDGCHC 1 cut(s) 431
SetI ASST 7 cut(s) 17, 124, 350, 504, 518, 551, 802
SfcI CTRYAG 1 cut(s) 161
Sse9I AATT 3 cut(s) 44, 55, 595
SspMI CTAG 1 cut(s) 434
StyD4I CCNGG 1 cut(s) 489
TaaI ACNGT 1 cut(s) 589
TaqI TCGA 3 cut(s) 59, 498, 773
TasI AATT 3 cut(s) 44, 55, 595
TfiI GAWTC 3 cut(s) 61, 166, 269
TscAI CASTG 4 cut(s) 75, 594, 621, 634
TseFI GTSAC 1 cut(s) 612
Tsp45I GTSAC 1 cut(s) 612
TspDTI ATGAA 2 cut(s) 316, 500
TspRI CASTG 4 cut(s) 75, 594, 621, 634
Van91I CCANNNNNTGG 1 cut(s) 676
XapI RAATTY 1 cut(s) 55
XspI CTAG 1 cut(s) 434
Zsp2I ATGCAT 1 cut(s) 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.