Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018264.1

Orthogroup ID

OG0008591

Physical Location & Seq

Genomic Coordinates Forward (+)

26639 .. 27307

Gene Structure 669 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018264.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

atgactttatacctcagctccccaccatggctctctcgtccatctccacccctccccgcttataacaacaccaacgccttgttcttcagactaagctcgacttctgtcaacttcccgaagctcattacaacaaaggcgtcgtctttgggcgagagtgaaagtgctagtgggattgcagaggactctgtttctgagcttttggacgaggacttgttaagtagagtttcgggtgctaaagatgcccaagaagcactcaagatatttgatgaaacggcagagagaaaaaatggaggtgtggtgttgatgccaatggccggaggtggaagtggtccagaccagatgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

114

Amino Acids

12.06

Weight (kDa)

4.56

Isoelectric Point (pI)

50.85

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008591)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G64430 AT1G64430 AT1G64430
fragaria_vesca	FvH4_5g04720 FvH4_5g04720
malus_domestica	MD06G1108400.v1.1
prunus_persica	Prupe.5G121000_v2.0.a1 Prupe.5G121000_v2.0.a1
pyrus_communis	pycom06g10180
rosa_chinensis	RchiOBHm_Chr7g0194681
rosa_laevigata	RLG00000004182
rosa_multiflora	Rmu_sc0018264.1_g000003 Rmu_sc0023803.1_g000001 Rmu_sc0034112.1_g000001
rosa_roxburghii	Rroxscaffold_3G00261160
rosa_rugosa	Rorug07G0017200 Rorug07G0017300 Rorug07G0017300
rosa_samantha	Rh7AG144700 Rh7BG144700 Rh7CG148500 Rh7DG145900
rosa_wichuraiana	Rw7G012360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	63
AciI	CCGC	1 cut(s)	57
AcoI	YGGCCR	1 cut(s)	312
AcuI	CTGAAG	1 cut(s)	70
AcyI	GRCGYC	1 cut(s)	137
AfiI	CCNNNNNNNGG	2 cut(s)	27, 314
AjuI	GAANNNNNNNTTGG	2 cut(s)	65, 97
AluBI	AGCT	4 cut(s)	18, 96, 121, 196
AluI	AGCT	4 cut(s)	18, 96, 121, 196
AoxI	GGCC	1 cut(s)	312
ArsI	GACNNNNNNTTYG	2 cut(s)	125, 157
AspS9I	GGNCC	1 cut(s)	329
AvaII	GGWCC	1 cut(s)	329
BbvCI	CCTCAGC	1 cut(s)	14
BccI	CCATC	1 cut(s)	49
BceAI	ACGGC	1 cut(s)	288
BfaI	CTAG	1 cut(s)	165
Bme18I	GGWCC	1 cut(s)	329
BmgT120I	GGNCC	1 cut(s)	329
BmsI	GCATC	2 cut(s)	229, 294
BoxI	GACNNNNGTC	1 cut(s)	104
Bpu10I	CCTNAGC	1 cut(s)	14
BpuEI	CTTGAG	1 cut(s)	239
BsaHI	GRCGYC	1 cut(s)	137
BsaJI	CCNNGG	1 cut(s)	26
BsaXI	ACNNNNNCTCC	3 cut(s)	32, 282, 312
Bsc4I	CCNNNNNNNGG	2 cut(s)	27, 314
BseDI	CCNNGG	1 cut(s)	26
BseLI	CCNNNNNNNGG	2 cut(s)	27, 314
BseMII	CTCAG	2 cut(s)	28, 183
BshFI	GGCC	1 cut(s)	314
BsiSI	CCGG	1 cut(s)	315
BslI	CCNNNNNNNGG	2 cut(s)	27, 314
BsnI	GGCC	1 cut(s)	314
Bsp19I	CCATGG	1 cut(s)	26
BspACI	CCGC	1 cut(s)	57
BspANI	GGCC	1 cut(s)	314
BspCNI	CTCAG	2 cut(s)	27, 184
BssECI	CCNNGG	1 cut(s)	26
BssNI	GRCGYC	1 cut(s)	137
BssT1I	CCWWGG	1 cut(s)	26
BstACI	GRCGYC	1 cut(s)	137
BstDEI	CTNAG	3 cut(s)	14, 92, 192
BstDSI	CCRYGG	1 cut(s)	26
BstMWI	GCNNNNNNNGC	2 cut(s)	239, 248
BstPAI	GACNNNNGTC	1 cut(s)	104
BsuRI	GGCC	1 cut(s)	314
BtgI	CCRYGG	1 cut(s)	26
Cfr13I	GGNCC	1 cut(s)	329
CseI	GACGC	1 cut(s)	126
CviAII	CATG	1 cut(s)	27
CviJI	RGCY	6 cut(s)	18, 31, 96, 121, 196, 314
CviKI_1	RGCY	6 cut(s)	18, 31, 96, 121, 196, 314
DdeI	CTNAG	3 cut(s)	14, 92, 192
EaeI	YGGCCR	1 cut(s)	312
Eco130I	CCWWGG	1 cut(s)	26
Eco47I	GGWCC	1 cut(s)	329
Eco57I	CTGAAG	1 cut(s)	70
EcoT14I	CCWWGG	1 cut(s)	26
ErhI	CCWWGG	1 cut(s)	26
FaeI	CATG	1 cut(s)	30
FaiI	YATR	3 cut(s)	10, 28, 63
FalI	AAGNNNNNCTT	2 cut(s)	85, 117
FatI	CATG	1 cut(s)	26
FauI	CCCGC	1 cut(s)	64
FspBI	CTAG	1 cut(s)	165
HaeIII	GGCC	1 cut(s)	314
HapII	CCGG	1 cut(s)	315
HgaI	GACGC	1 cut(s)	126
Hin1I	GRCGYC	1 cut(s)	137
Hin1II	CATG	1 cut(s)	30
HincII	GTYRAC	1 cut(s)	109
HindII	GTYRAC	1 cut(s)	109
HinfI	GANTC	1 cut(s)	182
HpaII	CCGG	1 cut(s)	315
Hpy166II	GTNNAC	1 cut(s)	109
Hpy188I	TCNGA	2 cut(s)	89, 193
Hpy188III	TCNNGA	3 cut(s)	115, 256, 332
Hpy8I	GTNNAC	1 cut(s)	109
Hpy99I	CGWCG	1 cut(s)	142
HpyCH4V	TGCA	1 cut(s)	176
HpyF10VI	GCNNNNNNNGC	2 cut(s)	239, 248
HpyF3I	CTNAG	3 cut(s)	14, 92, 192
Hsp92I	GRCGYC	1 cut(s)	137
Hsp92II	CATG	1 cut(s)	30
LmnI	GCTCC	1 cut(s)	23
LpnPI	CCDG	1 cut(s)	328
LweI	GCATC	2 cut(s)	229, 294
MaeI	CTAG	1 cut(s)	165
MboII	GAAGA	1 cut(s)	76
MlyI	GAGTC	1 cut(s)	176
MnlI	CCTC	6 cut(s)	23, 62, 172, 199, 284, 311
MseI	TTAA	1 cut(s)	215
MspI	CCGG	1 cut(s)	315
MwoI	GCNNNNNNNGC	2 cut(s)	239, 248
NcoI	CCATGG	1 cut(s)	26
NlaIII	CATG	1 cut(s)	30
PleI	GAGTC	1 cut(s)	176
PpsI	GAGTC	1 cut(s)	176
PshAI	GACNNNNGTC	1 cut(s)	104
PsiI	TTATAA	1 cut(s)	63
PspPI	GGNCC	1 cut(s)	329
SaqAI	TTAA	1 cut(s)	215
Sau96I	GGNCC	1 cut(s)	329
SchI	GAGTC	1 cut(s)	176
SetI	ASST	7 cut(s)	15, 20, 98, 123, 198, 295, 322
SfaNI	GCATC	2 cut(s)	229, 294
SinI	GGWCC	1 cut(s)	329
SmlI	CTYRAG	1 cut(s)	254
SmoI	CTYRAG	1 cut(s)	254
SsiI	CCGC	1 cut(s)	57
SspMI	CTAG	1 cut(s)	165
StyI	CCWWGG	1 cut(s)	26
TaqI	TCGA	1 cut(s)	98
Tru1I	TTAA	1 cut(s)	215
Tru9I	TTAA	1 cut(s)	215
TspDTI	ATGAA	1 cut(s)	282
VpaK11BI	GGWCC	1 cut(s)	329
XspI	CTAG	1 cut(s)	165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.