Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0034112.1

Orthogroup ID

OG0008591

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 903

Gene Structure 903 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0034112.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 558 bp

atgactttatacctcagctccccaccatggctctctcgtccatctccacccctcccctcttataacaacaccaacgccttgttcttcagactaagcttgacttctgtcaacttcccgaagctcattacaacaaaggcgtcgtctttgggcgagagtgaaagtgctagtgagattgcagaggactctgtttctgagcttttggacgaggacttgttaagtatagtttcgggtgctaaagatgcccaagaagcactcaagatatttgatgaaacggcagagagaaaaaatggaggtgttgtgagtgtttctgattgttgtgctattatctctgctgccctgaaaaggaacaaccctgaattggctctctctgttttttacgaaatgcgggccagttttgatcaaggtgttgatgccaatggccggaggtggaagtggtccagaccagatgtgagtgtctacacatcattaattctgggtctggctgcatcattgagagtttctgatgcccttaagatgatcaacagtatatgccgagtcggagtgtctccagctgaggag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

186

Amino Acids

20.16

Weight (kDa)

4.91

Isoelectric Point (pI)

49.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008591)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G64430 AT1G64430 AT1G64430
fragaria_vesca	FvH4_5g04720 FvH4_5g04720
malus_domestica	MD06G1108400.v1.1
prunus_persica	Prupe.5G121000_v2.0.a1 Prupe.5G121000_v2.0.a1
pyrus_communis	pycom06g10180
rosa_chinensis	RchiOBHm_Chr7g0194681
rosa_laevigata	RLG00000004182
rosa_multiflora	Rmu_sc0018264.1_g000003 Rmu_sc0023803.1_g000001 Rmu_sc0034112.1_g000001
rosa_roxburghii	Rroxscaffold_3G00261160
rosa_rugosa	Rorug07G0017200 Rorug07G0017300 Rorug07G0017300
rosa_samantha	Rh7AG144700 Rh7BG144700 Rh7CG148500 Rh7DG145900
rosa_wichuraiana	Rw7G012360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	63
AccI	GTMKAC	1 cut(s)	456
AciI	CCGC	1 cut(s)	385
AcoI	YGGCCR	1 cut(s)	418
AcuI	CTGAAG	1 cut(s)	70
AcyI	GRCGYC	1 cut(s)	137
AfiI	CCNNNNNNNGG	4 cut(s)	27, 342, 358, 420
AflII	CTTAAG	1 cut(s)	509
AjuI	GAANNNNNNNTTGG	2 cut(s)	65, 97
AluBI	AGCT	5 cut(s)	18, 96, 121, 196, 551
AluI	AGCT	5 cut(s)	18, 96, 121, 196, 551
Alw26I	GTCTC	1 cut(s)	549
AoxI	GGCC	2 cut(s)	387, 418
ApeKI	GCWGC	2 cut(s)	332, 482
ArsI	GACNNNNNNTTYG	2 cut(s)	125, 157
AseI	ATTAAT	1 cut(s)	467
AspS9I	GGNCC	2 cut(s)	387, 435
AvaII	GGWCC	1 cut(s)	435
BbvCI	CCTCAGC	2 cut(s)	14, 552
BbvI	GCAGC	2 cut(s)	319, 469
BccI	CCATC	1 cut(s)	49
BceAI	ACGGC	1 cut(s)	288
BclI	TGATCA	2 cut(s)	397, 516
BcoDI	GTCTC	1 cut(s)	549
BfaI	CTAG	1 cut(s)	165
BfrI	CTTAAG	1 cut(s)	509
BisI	GCNGC	2 cut(s)	333, 483
BlsI	GCNGC	2 cut(s)	334, 484
Bme18I	GGWCC	1 cut(s)	435
BmgT120I	GGNCC	2 cut(s)	387, 435
BmsI	GCATC	4 cut(s)	229, 400, 493, 494
BoxI	GACNNNNGTC	1 cut(s)	104
BpmI	CTGGAG	1 cut(s)	531
Bpu10I	CCTNAGC	2 cut(s)	14, 552
BpuEI	CTTGAG	1 cut(s)	239
BsaHI	GRCGYC	1 cut(s)	137
BsaJI	CCNNGG	1 cut(s)	26
BsaXI	ACNNNNNCTCC	3 cut(s)	32, 282, 312
Bsc4I	CCNNNNNNNGG	4 cut(s)	27, 342, 358, 420
Bse1I	ACTGG	1 cut(s)	390
BseDI	CCNNGG	1 cut(s)	26
BseLI	CCNNNNNNNGG	4 cut(s)	27, 342, 358, 420
BseMII	CTCAG	3 cut(s)	28, 183, 543
BseNI	ACTGG	1 cut(s)	390
BseXI	GCAGC	2 cut(s)	319, 469
BshFI	GGCC	2 cut(s)	389, 420
BsiSI	CCGG	1 cut(s)	421
BslI	CCNNNNNNNGG	4 cut(s)	27, 342, 358, 420
BsmAI	GTCTC	1 cut(s)	549
BsnI	GGCC	2 cut(s)	389, 420
Bsp143I	GATC	2 cut(s)	397, 516
Bsp19I	CCATGG	1 cut(s)	26
BspACI	CCGC	1 cut(s)	385
BspANI	GGCC	2 cut(s)	389, 420
BspCNI	CTCAG	3 cut(s)	27, 184, 544
BspTI	CTTAAG	1 cut(s)	509
BsrI	ACTGG	1 cut(s)	390
BssECI	CCNNGG	1 cut(s)	26
BssMI	GATC	2 cut(s)	397, 516
BssNI	GRCGYC	1 cut(s)	137
BssT1I	CCWWGG	1 cut(s)	26
Bst4CI	ACNGT	1 cut(s)	524
BstACI	GRCGYC	1 cut(s)	137
BstAFI	CTTAAG	1 cut(s)	509
BstC8I	GCNNGC	1 cut(s)	387
BstDEI	CTNAG	4 cut(s)	14, 92, 192, 552
BstDSI	CCRYGG	1 cut(s)	26
BstKTI	GATC	2 cut(s)	400, 519
BstMAI	GTCTC	1 cut(s)	549
BstMBI	GATC	2 cut(s)	397, 516
BstMWI	GCNNNNNNNGC	2 cut(s)	239, 248
BstPAI	GACNNNNGTC	1 cut(s)	104
BstV1I	GCAGC	2 cut(s)	319, 469
BsuRI	GGCC	2 cut(s)	389, 420
BtgI	CCRYGG	1 cut(s)	26
Cac8I	GCNNGC	1 cut(s)	387
Cfr13I	GGNCC	2 cut(s)	387, 435
CseI	GACGC	1 cut(s)	126
CviAII	CATG	1 cut(s)	27
DdeI	CTNAG	4 cut(s)	14, 92, 192, 552
DpnI	GATC	2 cut(s)	399, 518
DpnII	GATC	2 cut(s)	397, 516
EaeI	YGGCCR	1 cut(s)	418
Eco130I	CCWWGG	1 cut(s)	26
Eco47I	GGWCC	1 cut(s)	435
Eco57I	CTGAAG	1 cut(s)	70
EcoT14I	CCWWGG	1 cut(s)	26
ErhI	CCWWGG	1 cut(s)	26
FaeI	CATG	1 cut(s)	30
FaiI	YATR	6 cut(s)	10, 28, 63, 221, 527, 529
FalI	AAGNNNNNCTT	2 cut(s)	85, 117
FatI	CATG	1 cut(s)	26
FauI	CCCGC	1 cut(s)	378
FbaI	TGATCA	2 cut(s)	397, 516
FblI	GTMKAC	1 cut(s)	456
Fnu4HI	GCNGC	2 cut(s)	333, 483
Fsp4HI	GCNGC	2 cut(s)	333, 483
FspBI	CTAG	1 cut(s)	165
GluI	GCNGC	2 cut(s)	333, 483
GsuI	CTGGAG	1 cut(s)	531
HaeIII	GGCC	2 cut(s)	389, 420
HapII	CCGG	1 cut(s)	421
HgaI	GACGC	1 cut(s)	126
Hin1I	GRCGYC	1 cut(s)	137
Hin1II	CATG	1 cut(s)	30
HincII	GTYRAC	1 cut(s)	109
HindII	GTYRAC	1 cut(s)	109
HindIII	AAGCTT	1 cut(s)	94
HinfI	GANTC	2 cut(s)	182, 534
HpaII	CCGG	1 cut(s)	421
Hpy166II	GTNNAC	2 cut(s)	109, 457
Hpy188I	TCNGA	5 cut(s)	89, 193, 310, 502, 539
Hpy188III	TCNNGA	3 cut(s)	115, 256, 438
Hpy8I	GTNNAC	2 cut(s)	109, 457
Hpy99I	CGWCG	1 cut(s)	142
HpyCH4III	ACNGT	1 cut(s)	524
HpyCH4V	TGCA	2 cut(s)	176, 485
HpyF10VI	GCNNNNNNNGC	2 cut(s)	239, 248
HpyF3I	CTNAG	4 cut(s)	14, 92, 192, 552
Hsp92I	GRCGYC	1 cut(s)	137
Hsp92II	CATG	1 cut(s)	30
Ksp22I	TGATCA	2 cut(s)	397, 516
Kzo9I	GATC	2 cut(s)	397, 516
LmnI	GCTCC	1 cut(s)	23
LpnPI	CCDG	8 cut(s)	350, 366, 403, 434, 451, 456, 458, 464
Lsp1109I	GCAGC	2 cut(s)	319, 469
LweI	GCATC	4 cut(s)	229, 400, 493, 494
MaeI	CTAG	1 cut(s)	165
MalI	GATC	2 cut(s)	399, 518
MboI	GATC	2 cut(s)	397, 516
MboII	GAAGA	1 cut(s)	76
MluCI	AATT	2 cut(s)	356, 468
MlyI	GAGTC	2 cut(s)	176, 543
MmeI	TCCRAC	1 cut(s)	517
MnlI	CCTC	8 cut(s)	23, 62, 67, 172, 199, 284, 417, 547
MseI	TTAA	3 cut(s)	215, 467, 510
MspA1I	CMGCKG	1 cut(s)	551
MspCI	CTTAAG	1 cut(s)	509
MspI	CCGG	1 cut(s)	421
MwoI	GCNNNNNNNGC	2 cut(s)	239, 248
NcoI	CCATGG	1 cut(s)	26
NdeII	GATC	2 cut(s)	397, 516
NlaIII	CATG	1 cut(s)	30
NmeAIII	GCCGAG	1 cut(s)	557
PkrI	GCNGC	2 cut(s)	334, 484
PleI	GAGTC	2 cut(s)	176, 542
PpsI	GAGTC	2 cut(s)	176, 542
PshAI	GACNNNNGTC	1 cut(s)	104
PshBI	ATTAAT	1 cut(s)	467
PsiI	TTATAA	1 cut(s)	63
PspPI	GGNCC	2 cut(s)	387, 435
PvuII	CAGCTG	1 cut(s)	551
SaqAI	TTAA	3 cut(s)	215, 467, 510
SatI	GCNGC	2 cut(s)	333, 483
Sau3AI	GATC	2 cut(s)	397, 516
Sau96I	GGNCC	2 cut(s)	387, 435
SchI	GAGTC	2 cut(s)	176, 543
SetI	ASST	9 cut(s)	15, 20, 98, 123, 198, 295, 406, 428, 553
SfaNI	GCATC	4 cut(s)	229, 400, 493, 494
SinI	GGWCC	1 cut(s)	435
SmlI	CTYRAG	2 cut(s)	254, 509
SmoI	CTYRAG	2 cut(s)	254, 509
Sse9I	AATT	2 cut(s)	356, 468
SsiI	CCGC	1 cut(s)	385
SspMI	CTAG	1 cut(s)	165
StyI	CCWWGG	1 cut(s)	26
TaaI	ACNGT	1 cut(s)	524
TasI	AATT	2 cut(s)	356, 468
Tru1I	TTAA	3 cut(s)	215, 467, 510
Tru9I	TTAA	3 cut(s)	215, 467, 510
TseI	GCWGC	2 cut(s)	332, 482
TspDTI	ATGAA	1 cut(s)	282
Vha464I	CTTAAG	1 cut(s)	509
VpaK11BI	GGWCC	1 cut(s)	435
VspI	ATTAAT	1 cut(s)	467
XmiI	GTMKAC	1 cut(s)	456
XspI	CTAG	1 cut(s)	165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.