Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018387.1

Orthogroup ID

OG0007730

Physical Location & Seq

Genomic Coordinates Reverse (-)

15594 .. 18411

Gene Structure 2818 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018387.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 894 bp

atgggtttgtttgggctgtggtggaatggaagtgcggtagggtttcttctattggtgccaggaattctgggttggggcaaagaaggccattatgcagtttgcaagatagcagagggatttctgagtgaagatgctttagctgcagtgaaagaattgctaccggtatctgctggaggtgatcttgctgcagtttgctcgtggcctgatgagattcgctttcattatcattggagtagtgctttacactatgttgacacacccgattttctgtgtaactacaattacagcagagactgccatgactctgctggacataaagggagatgtgtaactgcagcaatatacaactatacgatgcaacttttgacttatcaggattccatctcaaaatcaaaatacaacttaacagaggcacttcttttcttgtcccactttattggggatgtccatcagcccctacatgttggtttcactggagatctaggggggaacacaataatagtccgttggtatcgcaggaagacaaatcttcaccatgtgtgggataatatgatcattgaatctgctgtaaagacaatgtacagtgaggatcttggactcatgatagaagccattcagaggaatattacggatgcttggttcaatgatatgtcatcattgcagatttgtacaaataatcggacaactgtatgcccaaatgagtatgcttctgaaagcattcgtttagcatgcaaatttgcttacaggaatgccactccaggaagcactctgagtgatgattactttctttctcggctacctgtcgtggagaagcggctagctcaaagtggggttcgcttggctgctaccctcaaccatatcttctcttctgaaccaaaaattgctgaagcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000014 GO:0003674 GO:0003824 GO:0004518 GO:0004519 GO:0004520 GO:0004536 GO:0005575 GO:0005576 GO:0006139 GO:0006259 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043765 GO:0044237 GO:0044238 GO:0044260 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0140097 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

S1-P1_nuclease

Protein Analysis

297

Amino Acids

33.24

Weight (kDa)

6.04

Isoelectric Point (pI)

47.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007730)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G21585 AT4G21585 AT4G21585 AT4G21585 AT4G21585 AT4G21585 AT4G21590 AT4G21590 AT4G21600
fragaria_vesca	FvH4_3g04350 FvH4_3g04350
malus_domestica	MD05G1323700.v1.1
prunus_persica	Prupe.4G038800_v2.0.a1
pyrus_communis	pycom05g29810
rosa_chinensis	RchiOBHm_Chr5g0006741
rosa_laevigata	RLG00000031424
rosa_multiflora	Rmu_sc0017347.1_g000006 Rmu_sc0018387.1_g000005
rosa_rugosa	Rorug04G0424100
rosa_samantha	Rh5AG052000 Rh5BG050900 Rh5CG059500 Rh5DG050000
rosa_wichuraiana	Rw5G005250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	55
AciI	CCGC	2 cut(s)	35, 814
AclWI	GGATC	1 cut(s)	597
AcsI	RAATTY	2 cut(s)	63, 734
AdeI	CACNNNGTG	1 cut(s)	538
AfaI	GTAC	2 cut(s)	581, 670
AfiI	CCNNNNNNNGG	2 cut(s)	541, 618
AflIII	ACRYGT	1 cut(s)	460
AgeI	ACCGGT	1 cut(s)	160
AgsI	TTSAA	2 cut(s)	560, 643
AjnI	CCWGG	2 cut(s)	58, 757
AjuI	GAANNNNNNNTTGG	2 cut(s)	55, 87
AloI	GAACNNNNNNTCC	2 cut(s)	623, 655
AluBI	AGCT	2 cut(s)	140, 821
AluI	AGCT	2 cut(s)	140, 821
Alw26I	GTCTC	1 cut(s)	285
AlwI	GGATC	1 cut(s)	597
AlwNI	CAGNNNCTG	1 cut(s)	294
AoxI	GGCC	2 cut(s)	85, 200
ApeKI	GCWGC	4 cut(s)	140, 185, 335, 842
ApoI	RAATTY	2 cut(s)	63, 734
AsiGI	ACCGGT	1 cut(s)	160
Asp700I	GAANNNNTTC	2 cut(s)	612, 717
AsuHPI	GGTGA	2 cut(s)	188, 524
AsuNHI	GCTAGC	1 cut(s)	817
BanI	GGYRCC	1 cut(s)	55
BarI	GAAGNNNNNNTAC	2 cut(s)	30, 62
BauI	CACGAG	1 cut(s)	196
BbsI	GAAGAC	1 cut(s)	527
BbvI	GCAGC	4 cut(s)	127, 172, 347, 829
BccI	CCATC	2 cut(s)	389, 456
BcgI	CGANNNNNNTGC	2 cut(s)	177, 211
BciT130I	CCWGG	2 cut(s)	60, 759
BclI	TGATCA	1 cut(s)	552
BcoDI	GTCTC	1 cut(s)	285
BfaI	CTAG	2 cut(s)	482, 818
BfmI	CTRYAG	3 cut(s)	141, 186, 333
BglII	AGATCT	1 cut(s)	478
BisI	GCNGC	5 cut(s)	141, 186, 336, 815, 843
BlsI	GCNGC	5 cut(s)	142, 187, 337, 816, 844
Bme1390I	CCNGG	2 cut(s)	60, 759
BmiI	GGNNCC	1 cut(s)	57
BmrFI	CCNGG	2 cut(s)	60, 759
BmsI	GCATC	3 cut(s)	121, 345, 622
BmtI	GCTAGC	1 cut(s)	821
BpiI	GAAGAC	1 cut(s)	527
BpmI	CTGGAG	3 cut(s)	192, 495, 741
BsaBI	GATNNNNATC	1 cut(s)	447
BsaWI	WCCGGW	1 cut(s)	160
Bsc4I	CCNNNNNNNGG	2 cut(s)	541, 618
Bse118I	RCCGGY	1 cut(s)	160
Bse1I	ACTGG	1 cut(s)	478
Bse3DI	GCAATG	1 cut(s)	656
Bse8I	GATNNNNATC	1 cut(s)	447
BseBI	CCWGG	2 cut(s)	60, 759
BseGI	GGATG	2 cut(s)	448, 637
BseJI	GATNNNNATC	1 cut(s)	447
BseLI	CCNNNNNNNGG	2 cut(s)	541, 618
BseMI	GCAATG	1 cut(s)	656
BseMII	CTCAG	2 cut(s)	113, 761
BseNI	ACTGG	1 cut(s)	478
BseXI	GCAGC	4 cut(s)	127, 172, 347, 829
BshFI	GGCC	2 cut(s)	87, 202
BshNI	GGYRCC	1 cut(s)	55
BshTI	ACCGGT	1 cut(s)	160
BsiSI	CCGG	1 cut(s)	161
BslFI	GGGAC	1 cut(s)	412
BslI	CCNNNNNNNGG	2 cut(s)	541, 618
BsmAI	GTCTC	1 cut(s)	285
BsmFI	GGGAC	1 cut(s)	412
BsmI	GAATGC	2 cut(s)	717, 754
BsnI	GGCC	2 cut(s)	87, 202
Bsp1407I	TGTACA	2 cut(s)	579, 668
Bsp143I	GATC	4 cut(s)	178, 478, 552, 589
BspACI	CCGC	2 cut(s)	35, 814
BspANI	GGCC	2 cut(s)	87, 202
BspCNI	CTCAG	2 cut(s)	114, 762
BspHI	TCATGA	1 cut(s)	600
BspLI	GGNNCC	1 cut(s)	57
BspMAI	CTGCAG	3 cut(s)	145, 190, 337
BspOI	GCTAGC	1 cut(s)	821
BspPI	GGATC	1 cut(s)	597
BspT107I	GGYRCC	1 cut(s)	55
BsrDI	GCAATG	1 cut(s)	656
BsrFI	RCCGGY	1 cut(s)	160
BsrGI	TGTACA	2 cut(s)	579, 668
BsrI	ACTGG	1 cut(s)	478
BssAI	RCCGGY	1 cut(s)	160
BssMI	GATC	4 cut(s)	178, 478, 552, 589
BssSI	CACGAG	1 cut(s)	196
Bst2BI	CACGAG	1 cut(s)	196
Bst2UI	CCWGG	2 cut(s)	60, 759
Bst4CI	ACNGT	2 cut(s)	584, 688
Bst6I	CTCTTC	1 cut(s)	871
BstAPI	GCANNNNNTGC	1 cut(s)	294
BstAUI	TGTACA	2 cut(s)	579, 668
BstC8I	GCNNGC	2 cut(s)	730, 819
BstDEI	CTNAG	2 cut(s)	122, 770
BstF5I	GGATG	2 cut(s)	448, 637
BstKTI	GATC	4 cut(s)	181, 481, 555, 592
BstMAI	GTCTC	1 cut(s)	285
BstMBI	GATC	4 cut(s)	178, 478, 552, 589
BstMWI	GCNNNNNNNGC	3 cut(s)	84, 140, 294
BstNI	CCWGG	2 cut(s)	60, 759
BstNSI	RCATGY	2 cut(s)	464, 732
BstSCI	CCNGG	2 cut(s)	58, 757
BstSFI	CTRYAG	3 cut(s)	141, 186, 333
BstV1I	GCAGC	4 cut(s)	127, 172, 347, 829
BstV2I	GAAGAC	1 cut(s)	527
BstX2I	RGATCY	2 cut(s)	478, 589
BstXI	CCANNNNNNTGG	1 cut(s)	437
BstYI	RGATCY	2 cut(s)	478, 589
BsuRI	GGCC	2 cut(s)	87, 202
BtsCI	GGATG	2 cut(s)	448, 637
BtsI	GCAGTG	1 cut(s)	150
BtsIMutI	CAGTG	3 cut(s)	150, 471, 589
Cac8I	GCNNGC	2 cut(s)	730, 819
CaiI	CAGNNNCTG	1 cut(s)	294
CciI	TCATGA	1 cut(s)	600
Cfr10I	RCCGGY	1 cut(s)	160
Csp6I	GTAC	2 cut(s)	580, 669
CspAI	ACCGGT	1 cut(s)	160
CviAII	CATG	6 cut(s)	299, 461, 536, 601, 729, 891
CviQI	GTAC	2 cut(s)	580, 669
DdeI	CTNAG	2 cut(s)	122, 770
DpnI	GATC	4 cut(s)	180, 480, 554, 591
DpnII	GATC	4 cut(s)	178, 478, 552, 589
DraIII	CACNNNGTG	1 cut(s)	538
Eam1104I	CTCTTC	1 cut(s)	871
EarI	CTCTTC	1 cut(s)	871
EcoRI	GAATTC	1 cut(s)	63
EcoRII	CCWGG	2 cut(s)	58, 757
FaeI	CATG	6 cut(s)	302, 464, 539, 604, 732, 894
FaqI	GGGAC	1 cut(s)	412
FatI	CATG	6 cut(s)	298, 460, 535, 600, 728, 890
FbaI	TGATCA	1 cut(s)	552
Fnu4HI	GCNGC	5 cut(s)	141, 186, 336, 815, 843
FokI	GGATG	2 cut(s)	455, 644
Fsp4HI	GCNGC	5 cut(s)	141, 186, 336, 815, 843
FspBI	CTAG	2 cut(s)	482, 818
GluI	GCNGC	5 cut(s)	141, 186, 336, 815, 843
GsuI	CTGGAG	3 cut(s)	192, 495, 741
HaeIII	GGCC	2 cut(s)	87, 202
HapII	CCGG	1 cut(s)	161
Hin1II	CATG	6 cut(s)	302, 464, 539, 604, 732, 894
HincII	GTYRAC	1 cut(s)	253
HindII	GTYRAC	1 cut(s)	253
HinfI	GANTC	5 cut(s)	211, 302, 377, 560, 597
HpaII	CCGG	1 cut(s)	161
HphI	GGTGA	2 cut(s)	188, 524
Hpy166II	GTNNAC	1 cut(s)	253
Hpy188I	TCNGA	6 cut(s)	123, 618, 681, 712, 771, 871
Hpy188III	TCNNGA	2 cut(s)	374, 601
Hpy8I	GTNNAC	1 cut(s)	253
HpyAV	CCTTC	1 cut(s)	77
HpyCH4III	ACNGT	2 cut(s)	584, 688
HpyCH4V	TGCA	8 cut(s)	95, 102, 143, 188, 335, 358, 661, 732
HpyF10VI	GCNNNNNNNGC	3 cut(s)	84, 140, 294
HpyF3I	CTNAG	2 cut(s)	122, 770
Hsp92II	CATG	6 cut(s)	302, 464, 539, 604, 732, 894
Ksp22I	TGATCA	1 cut(s)	552
Kzo9I	GATC	4 cut(s)	178, 478, 552, 589
Lsp1109I	GCAGC	4 cut(s)	127, 172, 347, 829
LweI	GCATC	3 cut(s)	121, 345, 622
MaeI	CTAG	2 cut(s)	482, 818
MaeIII	GTNAC	2 cut(s)	272, 328
MalI	GATC	4 cut(s)	180, 480, 554, 591
MboI	GATC	4 cut(s)	178, 478, 552, 589
MboII	GAAGA	6 cut(s)	38, 140, 521, 532, 853, 858
MflI	RGATCY	2 cut(s)	478, 589
MluCI	AATT	5 cut(s)	63, 152, 280, 734, 879
MlyI	GAGTC	2 cut(s)	296, 591
MnlI	CCTC	6 cut(s)	106, 167, 403, 580, 612, 860
MroXI	GAANNNNTTC	2 cut(s)	612, 717
MseI	TTAA	1 cut(s)	404
MspI	CCGG	1 cut(s)	161
MspR9I	CCNGG	2 cut(s)	60, 759
Mva1269I	GAATGC	2 cut(s)	717, 754
MvaI	CCWGG	2 cut(s)	60, 759
MwoI	GCNNNNNNNGC	3 cut(s)	84, 140, 294
NdeII	GATC	4 cut(s)	178, 478, 552, 589
NheI	GCTAGC	1 cut(s)	817
NlaIII	CATG	6 cut(s)	302, 464, 539, 604, 732, 894
NlaIV	GGNNCC	1 cut(s)	57
NmeAIII	GCCGAG	1 cut(s)	772
NspI	RCATGY	2 cut(s)	464, 732
PaeI	GCATGC	1 cut(s)	732
PagI	TCATGA	1 cut(s)	600
PciI	ACATGT	1 cut(s)	460
PctI	GAATGC	2 cut(s)	717, 754
PdmI	GAANNNNTTC	2 cut(s)	612, 717
PfeI	GAWTC	3 cut(s)	211, 377, 560
PfoI	TCCNGGA	1 cut(s)	757
PinAI	ACCGGT	1 cut(s)	160
PkrI	GCNGC	5 cut(s)	142, 187, 337, 816, 844
PleI	GAGTC	2 cut(s)	296, 591
PpsI	GAGTC	2 cut(s)	296, 591
PscI	ACATGT	1 cut(s)	460
Psp6I	CCWGG	2 cut(s)	58, 757
PspGI	CCWGG	2 cut(s)	58, 757
PspN4I	GGNNCC	1 cut(s)	57
PstI	CTGCAG	3 cut(s)	145, 190, 337
PstNI	CAGNNNCTG	1 cut(s)	294
PsuI	RGATCY	2 cut(s)	478, 589
RsaI	GTAC	2 cut(s)	581, 670
RsaNI	GTAC	2 cut(s)	580, 669
SaqAI	TTAA	1 cut(s)	404
SatI	GCNGC	5 cut(s)	141, 186, 336, 815, 843
Sau3AI	GATC	4 cut(s)	178, 478, 552, 589
SchI	GAGTC	2 cut(s)	296, 591
ScrFI	CCNGG	2 cut(s)	60, 759
SetI	ASST	4 cut(s)	142, 178, 802, 823
SfaNI	GCATC	3 cut(s)	121, 345, 622
SfcI	CTRYAG	3 cut(s)	141, 186, 333
SphI	GCATGC	1 cut(s)	732
Sse9I	AATT	5 cut(s)	63, 152, 280, 734, 879
SsiI	CCGC	2 cut(s)	35, 814
SspI	AATATT	1 cut(s)	625
SspMI	CTAG	2 cut(s)	482, 818
StyD4I	CCNGG	2 cut(s)	58, 757
TaaI	ACNGT	2 cut(s)	584, 688
TasI	AATT	5 cut(s)	63, 152, 280, 734, 879
TatI	WGTACW	2 cut(s)	579, 668
TauI	GCSGC	1 cut(s)	817
TfiI	GAWTC	3 cut(s)	211, 377, 560
Tru1I	TTAA	1 cut(s)	404
Tru9I	TTAA	1 cut(s)	404
TscAI	CASTG	3 cut(s)	150, 478, 589
TseI	GCWGC	4 cut(s)	140, 185, 335, 842
TspDTI	ATGAA	1 cut(s)	209
TspGWI	ACGGA	2 cut(s)	494, 644
TspRI	CASTG	3 cut(s)	150, 478, 589
XapI	RAATTY	2 cut(s)	63, 734
XceI	RCATGY	2 cut(s)	464, 732
XcmI	CCANNNNNNNNNTGG	1 cut(s)	305
XmnI	GAANNNNTTC	2 cut(s)	612, 717
XspI	CTAG	2 cut(s)	482, 818

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.