Rmu_sc0019587.1_g000005

Calmodulin-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019587.1
Physical Location & Seq
Forward (+)
35577 .. 36251
675 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019587.1_g000005.1.cds

Sequence Viewer

Length: 675 bp
atgccaaccattttggtcaggattttccttatttacaatcttcttaatgcattcctcctctctttggtacccaaaaaactgagacctcttctcccctcatgttggtttcctgacataaaccaaaacgaagccaaagccaaaaccagaaccaaaacaagaaccagtgttgctgacaagaacaagggtcagggtcaggatcaagatcagctgagaatcacaagaatggagccgactgagctgaagcgcgtgttccaaatgttcgatcagaacggcgacgggcgcatcagcagaaaggagctgagcgattcgctggagaacttgggcatcttcatccctgacaaggagctgttcaacatgatccagaagatcgacgtcgacggagacgggtgcgtcgacattgacgagttcggagagctgtaccaatccataatggacgagcggaacgaggaggaagacatgaaggaggcattcaacgttttcgatcagaacggtgatggcttcatcgccgtcgacgagttgaggtccgtcttgtcctccctcggcctcaagcaaggcaagtccatagaggactgcaagaggatgattatgaatgtcgacgtcgatggagatggcagggtcaattacaaggagttcaagcagatgatgaagggaggaggctttagcgctttaacatag

Protein Analysis

224

Amino Acids

25.56

Weight (kDa)

4.9

Isoelectric Point (pI)

36.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013958)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 389
AatII GACGTC 2 cut(s) 375, 600
Acc65I GGTACC 1 cut(s) 67
AccB1I GGYRCC 1 cut(s) 67
AccBSI CCGCTC 1 cut(s) 439
AccI GTMKAC 4 cut(s) 375, 393, 510, 594
AccII CGCG 1 cut(s) 246
AciI CCGC 1 cut(s) 439
AclI AACGTT 1 cut(s) 474
AclWI GGATC 2 cut(s) 204, 352
AcuI CTGAAG 1 cut(s) 260
AcyI GRCGYC 2 cut(s) 372, 597
AfaI GTAC 2 cut(s) 69, 419
AfeI AGCGCT 1 cut(s) 664
AfiI CCNNNNNNNGG 3 cut(s) 64, 102, 340
AgsI TTSAA 3 cut(s) 352, 472, 634
AluBI AGCT 5 cut(s) 208, 238, 298, 346, 415
AluI AGCT 5 cut(s) 208, 238, 298, 346, 415
Alw26I GTCTC 2 cut(s) 76, 375
AlwI GGATC 2 cut(s) 204, 352
Aor51HI AGCGCT 1 cut(s) 664
AoxI GGCC 1 cut(s) 541
Asp718I GGTACC 1 cut(s) 67
AspLEI GCGC 3 cut(s) 246, 282, 665
AspS9I GGNCC 1 cut(s) 522
AsuHPI GGTGA 1 cut(s) 503
AvaII GGWCC 1 cut(s) 522
BanI GGYRCC 1 cut(s) 67
BbsI GAAGAC 1 cut(s) 459
BccI CCATC 3 cut(s) 488, 596, 602
BceAI ACGGC 2 cut(s) 286, 491
BcoDI GTCTC 2 cut(s) 76, 375
BfoI RGCGCY 1 cut(s) 666
BlpI GCTNAGC 1 cut(s) 299
Bme18I GGWCC 1 cut(s) 522
BmgT120I GGNCC 1 cut(s) 522
BmiI GGNNCC 2 cut(s) 69, 228
BmsI GCATC 2 cut(s) 291, 333
BpiI GAAGAC 1 cut(s) 459
BpmI CTGGAG 1 cut(s) 332
Bpu1102I GCTNAGC 1 cut(s) 299
BpuEI CTTGAG 1 cut(s) 530
BsaBI GATNNNNATC 1 cut(s) 201
BsaHI GRCGYC 2 cut(s) 372, 597
BsaI GGTCTC 1 cut(s) 76
BsaJI CCNNGG 1 cut(s) 538
BsaXI ACNNNNNCTCC 2 cut(s) 75, 105
Bsc4I CCNNNNNNNGG 3 cut(s) 64, 102, 340
Bse1I ACTGG 1 cut(s) 162
Bse8I GATNNNNATC 1 cut(s) 201
BseDI CCNNGG 1 cut(s) 538
BseGI GGATG 2 cut(s) 330, 585
BseJI GATNNNNATC 1 cut(s) 201
BseLI CCNNNNNNNGG 3 cut(s) 64, 102, 340
BseMII CTCAG 4 cut(s) 71, 200, 225, 290
BseNI ACTGG 1 cut(s) 162
BseRI GAGGAG 3 cut(s) 47, 461, 666
Bsh1236I CGCG 1 cut(s) 246
BshFI GGCC 1 cut(s) 543
BshNI GGYRCC 1 cut(s) 67
BslI CCNNNNNNNGG 3 cut(s) 64, 102, 340
BsmAI GTCTC 2 cut(s) 76, 375
BsmBI CGTCTC 1 cut(s) 375
BsmI GAATGC 2 cut(s) 50, 467
BsnI GGCC 1 cut(s) 543
Bso31I GGTCTC 1 cut(s) 76
Bsp143I GATC 6 cut(s) 196, 202, 262, 357, 366, 481
Bsp1720I GCTNAGC 1 cut(s) 299
BspACI CCGC 1 cut(s) 439
BspANI GGCC 1 cut(s) 543
BspCNI CTCAG 4 cut(s) 72, 201, 226, 291
BspFNI CGCG 1 cut(s) 246
BspLI GGNNCC 2 cut(s) 69, 228
BspPI GGATC 2 cut(s) 204, 352
BspT107I GGYRCC 1 cut(s) 67
BspTNI GGTCTC 1 cut(s) 76
BsrBI CCGCTC 1 cut(s) 439
BsrI ACTGG 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 538
BssMI GATC 6 cut(s) 196, 202, 262, 357, 366, 481
BssNI GRCGYC 2 cut(s) 372, 597
Bst4CI ACNGT 1 cut(s) 491
Bst6I CTCTTC 1 cut(s) 93
BstACI GRCGYC 2 cut(s) 372, 597
BstDEI CTNAG 4 cut(s) 80, 209, 234, 299
BstF5I GGATG 2 cut(s) 330, 585
BstFNI CGCG 1 cut(s) 246
BstH2I RGCGCY 1 cut(s) 666
BstHHI GCGC 3 cut(s) 246, 282, 665
BstKTI GATC 6 cut(s) 199, 205, 265, 360, 369, 484
BstMAI GTCTC 2 cut(s) 76, 375
BstMBI GATC 6 cut(s) 196, 202, 262, 357, 366, 481
BstMWI GCNNNNNNNGC 2 cut(s) 235, 279
BstUI CGCG 1 cut(s) 246
BstV2I GAAGAC 1 cut(s) 459
BsuRI GGCC 1 cut(s) 543
BtgZI GCGATG 1 cut(s) 487
BtsCI GGATG 2 cut(s) 330, 585
BtsIMutI CAGTG 1 cut(s) 169
CfoI GCGC 3 cut(s) 246, 282, 665
Cfr13I GGNCC 1 cut(s) 522
CseI GACGC 1 cut(s) 379
Csp6I GTAC 2 cut(s) 68, 418
CviAII CATG 3 cut(s) 99, 355, 457
CviQI GTAC 2 cut(s) 68, 418
DdeI CTNAG 4 cut(s) 80, 209, 234, 299
DpnI GATC 6 cut(s) 198, 204, 264, 359, 368, 483
DpnII GATC 6 cut(s) 196, 202, 262, 357, 366, 481
DrdI GACNNNNNNGTC 1 cut(s) 389
DseDI GACNNNNNNGTC 1 cut(s) 389
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
Eco31I GGTCTC 1 cut(s) 76
Eco47I GGWCC 1 cut(s) 522
Eco47III AGCGCT 1 cut(s) 664
Eco57I CTGAAG 1 cut(s) 260
EcoT22I ATGCAT 1 cut(s) 52
Esp3I CGTCTC 1 cut(s) 375
FaeI CATG 3 cut(s) 102, 358, 460
FaiI YATR 8 cut(s) 100, 116, 356, 428, 458, 563, 587, 673
FatI CATG 3 cut(s) 98, 354, 456
FblI GTMKAC 4 cut(s) 375, 393, 510, 594
FokI GGATG 2 cut(s) 317, 592
GlaI GCGC 3 cut(s) 245, 281, 664
GsuI CTGGAG 1 cut(s) 332
HaeII RGCGCY 1 cut(s) 666
HaeIII GGCC 1 cut(s) 543
HgaI GACGC 1 cut(s) 379
HhaI GCGC 3 cut(s) 246, 282, 665
Hin1I GRCGYC 2 cut(s) 372, 597
Hin1II CATG 3 cut(s) 102, 358, 460
Hin6I GCGC 3 cut(s) 244, 280, 663
HinP1I GCGC 3 cut(s) 244, 280, 663
HincII GTYRAC 4 cut(s) 376, 394, 511, 595
HindII GTYRAC 4 cut(s) 376, 394, 511, 595
HinfI GANTC 2 cut(s) 213, 305
HphI GGTGA 1 cut(s) 503
Hpy166II GTNNAC 4 cut(s) 376, 394, 511, 595
Hpy188I TCNGA 3 cut(s) 267, 410, 486
Hpy188III TCNNGA 5 cut(s) 19, 110, 194, 200, 361
Hpy8I GTNNAC 4 cut(s) 376, 394, 511, 595
Hpy99I CGWCG 9 cut(s) 278, 374, 377, 380, 395, 512, 515, 599, 602
HpyAV CCTTC 2 cut(s) 454, 640
HpyCH4III ACNGT 1 cut(s) 491
HpyCH4IV ACGT 3 cut(s) 372, 474, 597
HpyCH4V TGCA 2 cut(s) 50, 573
HpyF10VI GCNNNNNNNGC 2 cut(s) 235, 279
HpyF3I CTNAG 4 cut(s) 80, 209, 234, 299
HpySE526I ACGT 3 cut(s) 372, 474, 597
Hsp92I GRCGYC 2 cut(s) 372, 597
Hsp92II CATG 3 cut(s) 102, 358, 460
HspAI GCGC 3 cut(s) 244, 280, 663
KpnI GGTACC 1 cut(s) 71
Kzo9I GATC 6 cut(s) 196, 202, 262, 357, 366, 481
LmnI GCTCC 3 cut(s) 226, 295, 343
LweI GCATC 2 cut(s) 291, 333
MaeII ACGT 3 cut(s) 372, 474, 597
MalI GATC 6 cut(s) 198, 204, 264, 359, 368, 483
MbiI CCGCTC 1 cut(s) 439
MboI GATC 6 cut(s) 196, 202, 262, 357, 366, 481
MboII GAAGA 5 cut(s) 32, 80, 319, 376, 464
MluCI AATT 1 cut(s) 619
Mph1103I ATGCAT 1 cut(s) 52
MseI TTAA 2 cut(s) 45, 668
MslI CAYNNNNRTG 1 cut(s) 221
MspA1I CMGCKG 1 cut(s) 208
Mva1269I GAATGC 2 cut(s) 50, 467
MvnI CGCG 1 cut(s) 246
MwoI GCNNNNNNNGC 2 cut(s) 235, 279
NdeII GATC 6 cut(s) 196, 202, 262, 357, 366, 481
NlaIII CATG 3 cut(s) 102, 358, 460
NlaIV GGNNCC 2 cut(s) 69, 228
NmeAIII GCCGAG 1 cut(s) 519
NsiI ATGCAT 1 cut(s) 52
PcsI WCGNNNNNNNCGW 4 cut(s) 390, 399, 441, 510
PctI GAATGC 2 cut(s) 50, 467
PfeI GAWTC 2 cut(s) 213, 305
Psp1406I AACGTT 1 cut(s) 474
PspN4I GGNNCC 2 cut(s) 69, 228
PspPI GGNCC 1 cut(s) 522
PvuII CAGCTG 1 cut(s) 208
RsaI GTAC 2 cut(s) 69, 419
RsaNI GTAC 2 cut(s) 68, 418
RseI CAYNNNNRTG 1 cut(s) 221
SalI GTCGAC 4 cut(s) 374, 392, 509, 593
SaqAI TTAA 2 cut(s) 45, 668
Sau3AI GATC 6 cut(s) 196, 202, 262, 357, 366, 481
Sau96I GGNCC 1 cut(s) 522
SfaNI GCATC 2 cut(s) 291, 333
SgrDI CGTCGACG 2 cut(s) 374, 509
SinI GGWCC 1 cut(s) 522
SmiMI CAYNNNNRTG 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 545
SmoI CTYRAG 1 cut(s) 545
Sse9I AATT 1 cut(s) 619
SsiI CCGC 1 cut(s) 439
TaaI ACNGT 1 cut(s) 491
TaiI ACGT 3 cut(s) 375, 477, 600
TaqI TCGA 8 cut(s) 261, 369, 375, 393, 480, 510, 594, 600
TasI AATT 1 cut(s) 619
TfiI GAWTC 2 cut(s) 213, 305
Tru1I TTAA 2 cut(s) 45, 668
Tru9I TTAA 2 cut(s) 45, 668
TscAI CASTG 1 cut(s) 169
TspDTI ATGAA 5 cut(s) 319, 473, 490, 602, 659
TspGWI ACGGA 2 cut(s) 393, 514
TspRI CASTG 1 cut(s) 169
VpaK11BI GGWCC 1 cut(s) 522
XmiI GTMKAC 4 cut(s) 375, 393, 510, 594
ZraI GACGTC 2 cut(s) 373, 598
Zsp2I ATGCAT 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.