Rmu_sc0021766.1_g000001

pre-rRNA processing protein involved in ribosome biogenesis

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021766.1
Physical Location & Seq
Forward (+)
1 .. 2916
2916 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021766.1_g000001.1.cds

Sequence Viewer

Length: 295 bp
tggggaagaggaaactgcaaatttgttgctcggaaagttcaaatggggtcatgctttcctatccctcaacagggaacttctaaaggcatactctaattgtgaaaacagtgctgagattatttcattccaaaatgcctggcttgcacaggaaagacaagttccaaaggttcctacagaagtagaagggggagagaggtcagctcgcagtgatgatgagggttcttatgattctgacgatgggcttccgccacttgaaaagaatatgaatcatttagacttagaggatagtgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.87

Weight (kDa)

4.39

Isoelectric Point (pI)

44.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 246
AcsI RAATTY 1 cut(s) 20
AfiI CCNNNNNNNGG 2 cut(s) 70, 71
AgsI TTSAA 2 cut(s) 41, 255
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 1 cut(s) 201
AluI AGCT 1 cut(s) 201
ApoI RAATTY 1 cut(s) 20
BccI CCATC 1 cut(s) 231
BciT130I CCWGG 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 172
Bme1390I CCNGG 1 cut(s) 137
BmiI GGNNCC 1 cut(s) 169
BmrFI CCNGG 1 cut(s) 137
BplI GAGNNNNNCTC 2 cut(s) 185, 217
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 71
BseBI CCWGG 1 cut(s) 137
BseLI CCNNNNNNNGG 2 cut(s) 70, 71
BseMII CTCAG 1 cut(s) 103
BslI CCNNNNNNNGG 2 cut(s) 70, 71
BspACI CCGC 1 cut(s) 246
BspCNI CTCAG 1 cut(s) 104
BspLI GGNNCC 1 cut(s) 169
Bst2UI CCWGG 1 cut(s) 137
Bst4CI ACNGT 1 cut(s) 108
BstC8I GCNNGC 2 cut(s) 142, 203
BstDEI CTNAG 2 cut(s) 112, 278
BstMWI GCNNNNNNNGC 1 cut(s) 141
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BstSFI CTRYAG 1 cut(s) 172
BtsI GCAGTG 1 cut(s) 212
BtsIMutI CAGTG 2 cut(s) 113, 212
Cac8I GCNNGC 2 cut(s) 142, 203
CviAII CATG 1 cut(s) 51
CviJI RGCY 3 cut(s) 140, 201, 242
CviKI_1 RGCY 3 cut(s) 140, 201, 242
DdeI CTNAG 2 cut(s) 112, 278
EciI GGCGGA 1 cut(s) 235
EcoRII CCWGG 1 cut(s) 135
FaeI CATG 1 cut(s) 54
FaiI YATR 4 cut(s) 52, 89, 226, 264
FatI CATG 1 cut(s) 50
Hin1II CATG 1 cut(s) 54
HinfI GANTC 2 cut(s) 228, 266
Hpy188I TCNGA 2 cut(s) 33, 233
HpyAV CCTTC 1 cut(s) 177
HpyCH4III ACNGT 1 cut(s) 108
HpyCH4V TGCA 2 cut(s) 18, 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 141
HpyF3I CTNAG 2 cut(s) 112, 278
Hsp92II CATG 1 cut(s) 54
LpnPI CCDG 4 cut(s) 56, 122, 132, 149
MboII GAAGA 1 cut(s) 18
MluCI AATT 2 cut(s) 20, 95
MnlI CCTC 4 cut(s) 75, 187, 209, 275
MseI TTAA 1 cut(s) 293
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 141
NlaIII CATG 1 cut(s) 54
NlaIV GGNNCC 1 cut(s) 169
PfeI GAWTC 2 cut(s) 228, 266
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 169
SaqAI TTAA 1 cut(s) 293
ScrFI CCNGG 1 cut(s) 137
SetI ASST 3 cut(s) 169, 198, 203
SfcI CTRYAG 1 cut(s) 172
Sse9I AATT 2 cut(s) 20, 95
SsiI CCGC 1 cut(s) 246
StyD4I CCNGG 1 cut(s) 135
TaaI ACNGT 1 cut(s) 108
TasI AATT 2 cut(s) 20, 95
TfiI GAWTC 2 cut(s) 228, 266
Tru1I TTAA 1 cut(s) 293
Tru9I TTAA 1 cut(s) 293
TscAI CASTG 2 cut(s) 113, 212
TspDTI ATGAA 2 cut(s) 112, 279
TspRI CASTG 2 cut(s) 113, 212
XapI RAATTY 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.