Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0021921.1

Orthogroup ID

OG0012471

Physical Location & Seq

Genomic Coordinates Reverse (-)

159 .. 683

Gene Structure 525 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0021921.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 444 bp

atggccattacaagcttcagctgcagccttaaccagctgcctcctccaactcaaagctcaggcccttcttctccttcaaagacgaatcaagtactacttgcatggaaaacaagtgatggaggatcatggagtagcagatgtgttctgggcatgacttgtgttatggttgggttggagatgggtggtttagtgagtggccaaagccatgaagctatagctaaaggtatgccgttggtgatgggatcgagtgagaaagttgcgaaatggagtgacaagagaatttgccccaagtggagagccaatgagctggagaccattgtgccggagaaccttccgaggccgtcggctcaccggagatgggaaatcgtcggttttaatactagggatgctccggcggttaaaatggtggctaggaggagtacaggtggttgcttttctatgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

147

Amino Acids

15.85

Weight (kDa)

9.55

Isoelectric Point (pI)

61.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012471)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G25625 AT2G25625
fragaria_vesca	FvH4_2g29860
malus_domestica	MD08G1140700.v1.1 MD15G1117600.v1.1
prunus_persica	Prupe.1G471000_v2.0.a1 Prupe.1G471000_v2.0.a1
pyrus_communis	pycom15g10600
rosa_chinensis	RchiOBHm_Chr6g0298931
rosa_laevigata	RLG00000011472
rosa_multiflora	Rmu_sc0021921.1_g000001 Rmu_sc0021922.1_g000001
rosa_roxburghii	Rroxscaffold_7G00169200
rosa_rugosa	Rorug06G0283800
rosa_samantha	Rh6AG395600 Rh6BG403700 Rh6CG409400 Rh6DG396400
rosa_wichuraiana	Rw6G034620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	395
AclWI	GGATC	2 cut(s)	130, 250
AcoI	YGGCCR	2 cut(s)	3, 196
AcsI	RAATTY	1 cut(s)	279
AfaI	GTAC	2 cut(s)	93, 421
AfiI	CCNNNNNNNGG	1 cut(s)	358
AgsI	TTSAA	1 cut(s)	78
AluBI	AGCT	7 cut(s)	15, 21, 37, 57, 212, 218, 307
AluI	AGCT	7 cut(s)	15, 21, 37, 57, 212, 218, 307
Alw26I	GTCTC	1 cut(s)	305
AlwI	GGATC	2 cut(s)	130, 250
AoxI	GGCC	4 cut(s)	3, 61, 196, 338
ApeKI	GCWGC	3 cut(s)	21, 24, 37
ApoI	RAATTY	1 cut(s)	279
AspS9I	GGNCC	1 cut(s)	62
AsuHPI	GGTGA	2 cut(s)	247, 341
BalI	TGGCCA	2 cut(s)	5, 198
BbvI	GCAGC	3 cut(s)	8, 24, 36
BccI	CCATC	4 cut(s)	110, 172, 232, 351
BceAI	ACGGC	2 cut(s)	214, 325
BcoDI	GTCTC	1 cut(s)	305
BfaI	CTAG	2 cut(s)	381, 411
BfmI	CTRYAG	2 cut(s)	22, 213
BisI	GCNGC	3 cut(s)	22, 25, 38
BlsI	GCNGC	3 cut(s)	23, 26, 39
BmcAI	AGTACT	1 cut(s)	93
BmgT120I	GGNCC	1 cut(s)	62
BmsI	GCATC	1 cut(s)	376
BpmI	CTGGAG	1 cut(s)	329
Bpu10I	CCTNAGC	1 cut(s)	58
BsaI	GGTCTC	1 cut(s)	305
BsaJI	CCNNGG	1 cut(s)	335
BsaWI	WCCGGW	1 cut(s)	351
BsaXI	ACNNNNNCTCC	2 cut(s)	409, 439
Bsc4I	CCNNNNNNNGG	1 cut(s)	358
BseDI	CCNNGG	1 cut(s)	335
BseGI	GGATG	1 cut(s)	391
BseLI	CCNNNNNNNGG	1 cut(s)	358
BseMII	CTCAG	1 cut(s)	72
BseRI	GAGGAG	2 cut(s)	33, 430
BseXI	GCAGC	3 cut(s)	8, 24, 36
BshFI	GGCC	4 cut(s)	5, 63, 198, 340
BsiSI	CCGG	3 cut(s)	323, 352, 392
BslI	CCNNNNNNNGG	1 cut(s)	358
BsmAI	GTCTC	1 cut(s)	305
BsnI	GGCC	4 cut(s)	5, 63, 198, 340
Bso31I	GGTCTC	1 cut(s)	305
Bsp143I	GATC	2 cut(s)	122, 242
BspACI	CCGC	1 cut(s)	395
BspANI	GGCC	4 cut(s)	5, 63, 198, 340
BspCNI	CTCAG	1 cut(s)	71
BspMAI	CTGCAG	1 cut(s)	26
BspPI	GGATC	2 cut(s)	130, 250
BspTNI	GGTCTC	1 cut(s)	305
BssECI	CCNNGG	1 cut(s)	335
BssMI	GATC	2 cut(s)	122, 242
BstDEI	CTNAG	1 cut(s)	58
BstF5I	GGATG	1 cut(s)	391
BstKTI	GATC	2 cut(s)	125, 245
BstMAI	GTCTC	1 cut(s)	305
BstMBI	GATC	2 cut(s)	122, 242
BstMWI	GCNNNNNNNGC	1 cut(s)	21
BstSFI	CTRYAG	2 cut(s)	22, 213
BstV1I	GCAGC	3 cut(s)	8, 24, 36
BstXI	CCANNNNNNTGG	1 cut(s)	307
BsuRI	GGCC	4 cut(s)	5, 63, 198, 340
BtsCI	GGATG	1 cut(s)	391
Cfr13I	GGNCC	1 cut(s)	62
Csp6I	GTAC	2 cut(s)	92, 420
CviAII	CATG	4 cut(s)	102, 126, 151, 206
CviQI	GTAC	2 cut(s)	92, 420
DdeI	CTNAG	1 cut(s)	58
DpnI	GATC	2 cut(s)	124, 244
DpnII	GATC	2 cut(s)	122, 242
EaeI	YGGCCR	2 cut(s)	3, 196
Eco31I	GGTCTC	1 cut(s)	305
EcoO109I	RGGNCCY	1 cut(s)	62
FaeI	CATG	4 cut(s)	105, 129, 154, 209
FaiI	YATR	8 cut(s)	103, 127, 152, 164, 207, 215, 227, 440
FalI	AAGNNNNNCTT	2 cut(s)	81, 113
FatI	CATG	4 cut(s)	101, 125, 150, 205
Fnu4HI	GCNGC	3 cut(s)	22, 25, 38
FokI	GGATG	1 cut(s)	398
Fsp4HI	GCNGC	3 cut(s)	22, 25, 38
FspBI	CTAG	2 cut(s)	381, 411
GluI	GCNGC	3 cut(s)	22, 25, 38
GsuI	CTGGAG	1 cut(s)	329
HaeIII	GGCC	4 cut(s)	5, 63, 198, 340
HapII	CCGG	3 cut(s)	323, 352, 392
Hin1II	CATG	4 cut(s)	105, 129, 154, 209
HindIII	AAGCTT	1 cut(s)	13
HinfI	GANTC	1 cut(s)	85
HpaII	CCGG	3 cut(s)	323, 352, 392
HphI	GGTGA	2 cut(s)	247, 341
Hpy188I	TCNGA	1 cut(s)	336
Hpy99I	CGWCG	2 cut(s)	346, 371
HpyAV	CCTTC	3 cut(s)	75, 84, 341
HpyCH4V	TGCA	2 cut(s)	24, 101
HpyF10VI	GCNNNNNNNGC	1 cut(s)	21
HpyF3I	CTNAG	1 cut(s)	58
Hsp92II	CATG	4 cut(s)	105, 129, 154, 209
Kzo9I	GATC	2 cut(s)	122, 242
LmnI	GCTCC	1 cut(s)	394
LpnPI	CCDG	8 cut(s)	45, 47, 131, 293, 336, 365, 405, 408
Lsp1109I	GCAGC	3 cut(s)	8, 24, 36
LweI	GCATC	1 cut(s)	376
MaeI	CTAG	2 cut(s)	381, 411
MaeIII	GTNAC	1 cut(s)	269
MalI	GATC	2 cut(s)	124, 244
MboI	GATC	2 cut(s)	122, 242
MboII	GAAGA	1 cut(s)	60
MlsI	TGGCCA	2 cut(s)	5, 198
MluCI	AATT	1 cut(s)	279
MluNI	TGGCCA	2 cut(s)	5, 198
MmeI	TCCRAC	2 cut(s)	71, 153
MnlI	CCTC	5 cut(s)	51, 54, 113, 330, 408
Mox20I	TGGCCA	2 cut(s)	5, 198
MscI	TGGCCA	2 cut(s)	5, 198
MseI	TTAA	3 cut(s)	30, 375, 399
Msp20I	TGGCCA	2 cut(s)	5, 198
MspA1I	CMGCKG	2 cut(s)	21, 37
MspI	CCGG	3 cut(s)	323, 352, 392
MwoI	GCNNNNNNNGC	1 cut(s)	21
NdeII	GATC	2 cut(s)	122, 242
NlaIII	CATG	4 cut(s)	105, 129, 154, 209
NmuCI	GTSAC	1 cut(s)	269
PfeI	GAWTC	1 cut(s)	85
PkrI	GCNGC	3 cut(s)	23, 26, 39
PspPI	GGNCC	1 cut(s)	62
PstI	CTGCAG	1 cut(s)	26
PvuII	CAGCTG	2 cut(s)	21, 37
RsaI	GTAC	2 cut(s)	93, 421
RsaNI	GTAC	2 cut(s)	92, 420
SaqAI	TTAA	3 cut(s)	30, 375, 399
SatI	GCNGC	3 cut(s)	22, 25, 38
Sau3AI	GATC	2 cut(s)	122, 242
Sau96I	GGNCC	1 cut(s)	62
ScaI	AGTACT	1 cut(s)	93
SfaNI	GCATC	1 cut(s)	376
SfcI	CTRYAG	2 cut(s)	22, 213
Sse9I	AATT	1 cut(s)	279
SsiI	CCGC	1 cut(s)	395
SspMI	CTAG	2 cut(s)	381, 411
TaqI	TCGA	1 cut(s)	245
TasI	AATT	1 cut(s)	279
TatI	WGTACW	2 cut(s)	91, 419
TfiI	GAWTC	1 cut(s)	85
Tru1I	TTAA	3 cut(s)	30, 375, 399
Tru9I	TTAA	3 cut(s)	30, 375, 399
TseFI	GTSAC	1 cut(s)	269
TseI	GCWGC	3 cut(s)	21, 24, 37
Tsp45I	GTSAC	1 cut(s)	269
TspDTI	ATGAA	1 cut(s)	222
XapI	RAATTY	1 cut(s)	279
XspI	CTAG	2 cut(s)	381, 411
ZrmI	AGTACT	1 cut(s)	93

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.