Rmu_sc0021922.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021922.1
Physical Location & Seq
Reverse (-)
159 .. 683
525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021922.1_g000001.1.cds

Sequence Viewer

Length: 444 bp
atggccattacaagcttcagctgcagccttaaccagctgcctcctccaactcaaagctcaggcccttcttctccttcaaagacgaatcaagtactacttgcatggaaaacaagtgatggaggatcatggagtagcagatgtgttctgggcatgacttgtgttatggttgggttggagatgggtggtttagtgagtggccaaagccatgaagctatagctaaaggtatgccgttggtgatgggatcgagtgagaaagttgcgaaatggagtgacaagagaatttgccccaagtggagagccaatgagctggagaccattgtgccggagaaccttccgaggccgtcggctcaccggagatgggaaatcgtcggttttaatactagggatgctccggcggttaaaatggtggctaggaggagtacaggtggttgcttttctatgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

15.85

Weight (kDa)

9.55

Isoelectric Point (pI)

61.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012471)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 395
AclWI GGATC 2 cut(s) 130, 250
AcoI YGGCCR 2 cut(s) 3, 196
AcsI RAATTY 1 cut(s) 279
AfaI GTAC 2 cut(s) 93, 421
AfiI CCNNNNNNNGG 1 cut(s) 358
AgsI TTSAA 1 cut(s) 78
AluBI AGCT 7 cut(s) 15, 21, 37, 57, 212, 218, 307
AluI AGCT 7 cut(s) 15, 21, 37, 57, 212, 218, 307
Alw26I GTCTC 1 cut(s) 305
AlwI GGATC 2 cut(s) 130, 250
AoxI GGCC 4 cut(s) 3, 61, 196, 338
ApeKI GCWGC 3 cut(s) 21, 24, 37
ApoI RAATTY 1 cut(s) 279
AspS9I GGNCC 1 cut(s) 62
AsuHPI GGTGA 2 cut(s) 247, 341
BalI TGGCCA 2 cut(s) 5, 198
BbvI GCAGC 3 cut(s) 8, 24, 36
BccI CCATC 4 cut(s) 110, 172, 232, 351
BceAI ACGGC 2 cut(s) 214, 325
BcoDI GTCTC 1 cut(s) 305
BfaI CTAG 2 cut(s) 381, 411
BfmI CTRYAG 2 cut(s) 22, 213
BisI GCNGC 3 cut(s) 22, 25, 38
BlsI GCNGC 3 cut(s) 23, 26, 39
BmcAI AGTACT 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 62
BmsI GCATC 1 cut(s) 376
BpmI CTGGAG 1 cut(s) 329
Bpu10I CCTNAGC 1 cut(s) 58
BsaI GGTCTC 1 cut(s) 305
BsaJI CCNNGG 1 cut(s) 335
BsaWI WCCGGW 1 cut(s) 351
BsaXI ACNNNNNCTCC 2 cut(s) 409, 439
Bsc4I CCNNNNNNNGG 1 cut(s) 358
BseDI CCNNGG 1 cut(s) 335
BseGI GGATG 1 cut(s) 391
BseLI CCNNNNNNNGG 1 cut(s) 358
BseMII CTCAG 1 cut(s) 72
BseRI GAGGAG 2 cut(s) 33, 430
BseXI GCAGC 3 cut(s) 8, 24, 36
BshFI GGCC 4 cut(s) 5, 63, 198, 340
BsiSI CCGG 3 cut(s) 323, 352, 392
BslI CCNNNNNNNGG 1 cut(s) 358
BsmAI GTCTC 1 cut(s) 305
BsnI GGCC 4 cut(s) 5, 63, 198, 340
Bso31I GGTCTC 1 cut(s) 305
Bsp143I GATC 2 cut(s) 122, 242
BspACI CCGC 1 cut(s) 395
BspANI GGCC 4 cut(s) 5, 63, 198, 340
BspCNI CTCAG 1 cut(s) 71
BspMAI CTGCAG 1 cut(s) 26
BspPI GGATC 2 cut(s) 130, 250
BspTNI GGTCTC 1 cut(s) 305
BssECI CCNNGG 1 cut(s) 335
BssMI GATC 2 cut(s) 122, 242
BstDEI CTNAG 1 cut(s) 58
BstF5I GGATG 1 cut(s) 391
BstKTI GATC 2 cut(s) 125, 245
BstMAI GTCTC 1 cut(s) 305
BstMBI GATC 2 cut(s) 122, 242
BstMWI GCNNNNNNNGC 1 cut(s) 21
BstSFI CTRYAG 2 cut(s) 22, 213
BstV1I GCAGC 3 cut(s) 8, 24, 36
BstXI CCANNNNNNTGG 1 cut(s) 307
BsuRI GGCC 4 cut(s) 5, 63, 198, 340
BtsCI GGATG 1 cut(s) 391
Cfr13I GGNCC 1 cut(s) 62
Csp6I GTAC 2 cut(s) 92, 420
CviAII CATG 4 cut(s) 102, 126, 151, 206
CviQI GTAC 2 cut(s) 92, 420
DdeI CTNAG 1 cut(s) 58
DpnI GATC 2 cut(s) 124, 244
DpnII GATC 2 cut(s) 122, 242
EaeI YGGCCR 2 cut(s) 3, 196
Eco31I GGTCTC 1 cut(s) 305
EcoO109I RGGNCCY 1 cut(s) 62
FaeI CATG 4 cut(s) 105, 129, 154, 209
FaiI YATR 8 cut(s) 103, 127, 152, 164, 207, 215, 227, 440
FalI AAGNNNNNCTT 2 cut(s) 81, 113
FatI CATG 4 cut(s) 101, 125, 150, 205
Fnu4HI GCNGC 3 cut(s) 22, 25, 38
FokI GGATG 1 cut(s) 398
Fsp4HI GCNGC 3 cut(s) 22, 25, 38
FspBI CTAG 2 cut(s) 381, 411
GluI GCNGC 3 cut(s) 22, 25, 38
GsuI CTGGAG 1 cut(s) 329
HaeIII GGCC 4 cut(s) 5, 63, 198, 340
HapII CCGG 3 cut(s) 323, 352, 392
Hin1II CATG 4 cut(s) 105, 129, 154, 209
HindIII AAGCTT 1 cut(s) 13
HinfI GANTC 1 cut(s) 85
HpaII CCGG 3 cut(s) 323, 352, 392
HphI GGTGA 2 cut(s) 247, 341
Hpy188I TCNGA 1 cut(s) 336
Hpy99I CGWCG 2 cut(s) 346, 371
HpyAV CCTTC 3 cut(s) 75, 84, 341
HpyCH4V TGCA 2 cut(s) 24, 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
HpyF3I CTNAG 1 cut(s) 58
Hsp92II CATG 4 cut(s) 105, 129, 154, 209
Kzo9I GATC 2 cut(s) 122, 242
LmnI GCTCC 1 cut(s) 394
LpnPI CCDG 8 cut(s) 45, 47, 131, 293, 336, 365, 405, 408
Lsp1109I GCAGC 3 cut(s) 8, 24, 36
LweI GCATC 1 cut(s) 376
MaeI CTAG 2 cut(s) 381, 411
MaeIII GTNAC 1 cut(s) 269
MalI GATC 2 cut(s) 124, 244
MboI GATC 2 cut(s) 122, 242
MboII GAAGA 1 cut(s) 60
MlsI TGGCCA 2 cut(s) 5, 198
MluCI AATT 1 cut(s) 279
MluNI TGGCCA 2 cut(s) 5, 198
MmeI TCCRAC 2 cut(s) 71, 153
MnlI CCTC 5 cut(s) 51, 54, 113, 330, 408
Mox20I TGGCCA 2 cut(s) 5, 198
MscI TGGCCA 2 cut(s) 5, 198
MseI TTAA 3 cut(s) 30, 375, 399
Msp20I TGGCCA 2 cut(s) 5, 198
MspA1I CMGCKG 2 cut(s) 21, 37
MspI CCGG 3 cut(s) 323, 352, 392
MwoI GCNNNNNNNGC 1 cut(s) 21
NdeII GATC 2 cut(s) 122, 242
NlaIII CATG 4 cut(s) 105, 129, 154, 209
NmuCI GTSAC 1 cut(s) 269
PfeI GAWTC 1 cut(s) 85
PkrI GCNGC 3 cut(s) 23, 26, 39
PspPI GGNCC 1 cut(s) 62
PstI CTGCAG 1 cut(s) 26
PvuII CAGCTG 2 cut(s) 21, 37
RsaI GTAC 2 cut(s) 93, 421
RsaNI GTAC 2 cut(s) 92, 420
SaqAI TTAA 3 cut(s) 30, 375, 399
SatI GCNGC 3 cut(s) 22, 25, 38
Sau3AI GATC 2 cut(s) 122, 242
Sau96I GGNCC 1 cut(s) 62
ScaI AGTACT 1 cut(s) 93
SfaNI GCATC 1 cut(s) 376
SfcI CTRYAG 2 cut(s) 22, 213
Sse9I AATT 1 cut(s) 279
SsiI CCGC 1 cut(s) 395
SspMI CTAG 2 cut(s) 381, 411
TaqI TCGA 1 cut(s) 245
TasI AATT 1 cut(s) 279
TatI WGTACW 2 cut(s) 91, 419
TfiI GAWTC 1 cut(s) 85
Tru1I TTAA 3 cut(s) 30, 375, 399
Tru9I TTAA 3 cut(s) 30, 375, 399
TseFI GTSAC 1 cut(s) 269
TseI GCWGC 3 cut(s) 21, 24, 37
Tsp45I GTSAC 1 cut(s) 269
TspDTI ATGAA 1 cut(s) 222
XapI RAATTY 1 cut(s) 279
XspI CTAG 2 cut(s) 381, 411
ZrmI AGTACT 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.