Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023498.1

Orthogroup ID

OG0010584

Physical Location & Seq

Genomic Coordinates Reverse (-)

9639 .. 10142

Gene Structure 504 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023498.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 504 bp

atgatcatccaccgagacataaagcctggacatatcttgttagaccaagactatgtagccaaactgtccgagttccaaatgtcaataccaattcctttgggaaaaacttatgtagatgttgcagaaaagactgggactcatgggtgccttgctccagagtacttttcctcaggacgtatttcagagaagagtgatgtccataactttggaattctattactagagctagtttcaggcagaagatggagtactctgctaatttgggatatgcagatctctaacgaaggcggtactagttcaagttcatatggccaactgaagtgcagaaagtctgaaaatctgtgtaagagcttcttggaggccaatgtggggctagaagaagaaaacaagaagcaagtagtggaaattgtcaagctagtagagaggtgcttgaaaaaagatccagatgataggcccatcatgacagacgtagcacaagcactcagattgattaaaaggttatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr

Protein Analysis

167

Amino Acids

18.86

Weight (kDa)

6.9

Isoelectric Point (pI)

40.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010584)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g28540
malus_domestica	MD17G1223800.v1.1
prunus_persica	Prupe.3G099400_v2.0.a1 Prupe.3G099500_v2.0.a1
pyrus_communis	pycom17g22760 pycom17g22770
rosa_chinensis	RchiOBHm_Chr2g0132861
rosa_laevigata	RLG00000019286
rosa_multiflora	Rmu_co8384525.1_g000001 Rmu_sc0023498.1_g000001 Rmu_sc0023498.1_g000002
rosa_rugosa	Rorug02G0307900
rosa_samantha	Rh2AG360300 Rh2AG360500 Rh2BG366300 Rh2BG366400 Rh2CG343700 Rh2DG383300 Rh2DG383400
rosa_wichuraiana	Rw2G029300 Rw2G029310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	144
AciI	CCGC	1 cut(s)	288
AclWI	GGATC	1 cut(s)	434
AcoI	YGGCCR	1 cut(s)	310
AcsI	RAATTY	1 cut(s)	210
AcuI	CTGAAG	1 cut(s)	338
AfaI	GTAC	3 cut(s)	161, 250, 292
AfiI	CCNNNNNNNGG	1 cut(s)	369
AgsI	TTSAA	2 cut(s)	300, 433
AhlI	ACTAGT	1 cut(s)	293
AjnI	CCWGG	1 cut(s)	25
AluBI	AGCT	3 cut(s)	226, 351, 415
AluI	AGCT	3 cut(s)	226, 351, 415
Alw26I	GTCTC	1 cut(s)	9
AlwI	GGATC	1 cut(s)	434
AoxI	GGCC	3 cut(s)	310, 360, 452
ApoI	RAATTY	1 cut(s)	210
AspS9I	GGNCC	1 cut(s)	453
AxyI	CCTNAGG	1 cut(s)	169
BalI	TGGCCA	1 cut(s)	312
BanI	GGYRCC	1 cut(s)	144
BarI	GAAGNNNNNNTAC	2 cut(s)	232, 264
BccI	CCATC	2 cut(s)	237, 464
BciT130I	CCWGG	1 cut(s)	27
BclI	TGATCA	1 cut(s)	3
BcoDI	GTCTC	1 cut(s)	9
BcuI	ACTAGT	1 cut(s)	293
BfaI	CTAG	5 cut(s)	221, 227, 294, 374, 416
BglII	AGATCT	1 cut(s)	273
BmcAI	AGTACT	2 cut(s)	161, 250
Bme1390I	CCNGG	1 cut(s)	27
BmgT120I	GGNCC	1 cut(s)	453
BmiI	GGNNCC	1 cut(s)	146
BmrFI	CCNGG	1 cut(s)	27
BmrI	ACTGGG	1 cut(s)	141
BmuI	ACTGGG	1 cut(s)	141
BpmI	CTGGAG	1 cut(s)	138
Bsc4I	CCNNNNNNNGG	1 cut(s)	369
Bse1I	ACTGG	1 cut(s)	136
Bse21I	CCTNAGG	1 cut(s)	169
BseBI	CCWGG	1 cut(s)	27
BseGI	GGATG	1 cut(s)	6
BseLI	CCNNNNNNNGG	1 cut(s)	369
BseMII	CTCAG	2 cut(s)	183, 496
BseNI	ACTGG	1 cut(s)	136
BsgI	GTGCAG	1 cut(s)	343
BshFI	GGCC	3 cut(s)	312, 362, 454
BshNI	GGYRCC	1 cut(s)	144
BslFI	GGGAC	1 cut(s)	148
BslI	CCNNNNNNNGG	1 cut(s)	369
BsmAI	GTCTC	1 cut(s)	9
BsmFI	GGGAC	1 cut(s)	148
BsnI	GGCC	3 cut(s)	312, 362, 454
Bsp143I	GATC	3 cut(s)	3, 273, 439
BspACI	CCGC	1 cut(s)	288
BspANI	GGCC	3 cut(s)	312, 362, 454
BspCNI	CTCAG	2 cut(s)	182, 495
BspHI	TCATGA	1 cut(s)	459
BspLI	GGNNCC	1 cut(s)	146
BspPI	GGATC	1 cut(s)	434
BspT107I	GGYRCC	1 cut(s)	144
BsrI	ACTGG	1 cut(s)	136
BssMI	GATC	3 cut(s)	3, 273, 439
Bst2UI	CCWGG	1 cut(s)	27
Bst4CI	ACNGT	1 cut(s)	66
Bst6I	CTCTTC	1 cut(s)	182
BstDEI	CTNAG	2 cut(s)	169, 482
BstF5I	GGATG	1 cut(s)	6
BstKTI	GATC	3 cut(s)	6, 276, 442
BstMAI	GTCTC	1 cut(s)	9
BstMBI	GATC	3 cut(s)	3, 273, 439
BstNI	CCWGG	1 cut(s)	27
BstSCI	CCNGG	1 cut(s)	25
BstX2I	RGATCY	2 cut(s)	273, 439
BstXI	CCANNNNNNTGG	1 cut(s)	206
BstYI	RGATCY	2 cut(s)	273, 439
Bsu36I	CCTNAGG	1 cut(s)	169
BsuRI	GGCC	3 cut(s)	312, 362, 454
BtsCI	GGATG	1 cut(s)	6
CciI	TCATGA	1 cut(s)	459
Cfr13I	GGNCC	1 cut(s)	453
Csp6I	GTAC	3 cut(s)	160, 249, 291
CviAII	CATG	2 cut(s)	140, 460
CviJI	RGCY	9 cut(s)	25, 59, 226, 312, 351, 362, 373, 415, 454
CviKI_1	RGCY	9 cut(s)	25, 59, 226, 312, 351, 362, 373, 415, 454
CviQI	GTAC	3 cut(s)	160, 249, 291
DdeI	CTNAG	2 cut(s)	169, 482
DpnI	GATC	3 cut(s)	5, 275, 441
DpnII	GATC	3 cut(s)	3, 273, 439
EaeI	YGGCCR	1 cut(s)	310
Eam1104I	CTCTTC	1 cut(s)	182
EarI	CTCTTC	1 cut(s)	182
Eco57I	CTGAAG	1 cut(s)	338
Eco81I	CCTNAGG	1 cut(s)	169
EcoRI	GAATTC	1 cut(s)	210
EcoRII	CCWGG	1 cut(s)	25
FaeI	CATG	2 cut(s)	143, 463
FalI	AAGNNNNNCTT	2 cut(s)	338, 370
FaqI	GGGAC	1 cut(s)	148
FatI	CATG	2 cut(s)	139, 459
FauNDI	CATATG	1 cut(s)	307
FbaI	TGATCA	1 cut(s)	3
FspBI	CTAG	5 cut(s)	221, 227, 294, 374, 416
GsuI	CTGGAG	1 cut(s)	138
HaeIII	GGCC	3 cut(s)	312, 362, 454
Hin1II	CATG	2 cut(s)	143, 463
HinfI	GANTC	1 cut(s)	136
Hpy188I	TCNGA	4 cut(s)	70, 184, 334, 485
Hpy188III	TCNNGA	4 cut(s)	155, 171, 443, 460
HpyAV	CCTTC	1 cut(s)	278
HpyCH4III	ACNGT	1 cut(s)	66
HpyCH4IV	ACGT	2 cut(s)	175, 468
HpyCH4V	TGCA	3 cut(s)	122, 271, 324
HpyF3I	CTNAG	2 cut(s)	169, 482
HpySE526I	ACGT	2 cut(s)	175, 468
Hsp92II	CATG	2 cut(s)	143, 463
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	3 cut(s)	3, 273, 439
LmnI	GCTCC	1 cut(s)	157
LpnPI	CCDG	7 cut(s)	12, 39, 117, 156, 168, 219, 456
MaeI	CTAG	5 cut(s)	221, 227, 294, 374, 416
MaeII	ACGT	2 cut(s)	175, 468
MalI	GATC	3 cut(s)	5, 275, 441
MboI	GATC	3 cut(s)	3, 273, 439
MboII	GAAGA	4 cut(s)	199, 252, 389, 392
MflI	RGATCY	2 cut(s)	273, 439
MlsI	TGGCCA	1 cut(s)	312
MluCI	AATT	4 cut(s)	90, 210, 258, 405
MluNI	TGGCCA	1 cut(s)	312
MlyI	GAGTC	1 cut(s)	130
MnlI	CCTC	3 cut(s)	178, 352, 417
Mox20I	TGGCCA	1 cut(s)	312
MscI	TGGCCA	1 cut(s)	312
MseI	TTAA	1 cut(s)	492
Msp20I	TGGCCA	1 cut(s)	312
MspR9I	CCNGG	1 cut(s)	27
MvaI	CCWGG	1 cut(s)	27
NdeI	CATATG	1 cut(s)	307
NdeII	GATC	3 cut(s)	3, 273, 439
NlaIII	CATG	2 cut(s)	143, 463
NlaIV	GGNNCC	1 cut(s)	146
PagI	TCATGA	1 cut(s)	459
PleI	GAGTC	1 cut(s)	130
PpsI	GAGTC	1 cut(s)	130
Psp6I	CCWGG	1 cut(s)	25
PspGI	CCWGG	1 cut(s)	25
PspN4I	GGNNCC	1 cut(s)	146
PspPI	GGNCC	1 cut(s)	453
PsuI	RGATCY	2 cut(s)	273, 439
RsaI	GTAC	3 cut(s)	161, 250, 292
RsaNI	GTAC	3 cut(s)	160, 249, 291
SaqAI	TTAA	1 cut(s)	492
Sau3AI	GATC	3 cut(s)	3, 273, 439
Sau96I	GGNCC	1 cut(s)	453
ScaI	AGTACT	2 cut(s)	161, 250
SchI	GAGTC	1 cut(s)	130
ScrFI	CCNGG	1 cut(s)	27
SetI	ASST	7 cut(s)	178, 228, 353, 417, 428, 471, 500
SpeI	ACTAGT	1 cut(s)	293
Sse9I	AATT	4 cut(s)	90, 210, 258, 405
SsiI	CCGC	1 cut(s)	288
SspMI	CTAG	5 cut(s)	221, 227, 294, 374, 416
StyD4I	CCNGG	1 cut(s)	25
TaaI	ACNGT	1 cut(s)	66
TaiI	ACGT	2 cut(s)	178, 471
TasI	AATT	4 cut(s)	90, 210, 258, 405
TatI	WGTACW	2 cut(s)	159, 248
Tru1I	TTAA	1 cut(s)	492
Tru9I	TTAA	1 cut(s)	492
TspDTI	ATGAA	1 cut(s)	294
XapI	RAATTY	1 cut(s)	210
XspI	CTAG	5 cut(s)	221, 227, 294, 374, 416
ZrmI	AGTACT	2 cut(s)	161, 250

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.