Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023787.1

Orthogroup ID

OG0010736

Physical Location & Seq

Genomic Coordinates Forward (+)

4816 .. 7532

Gene Structure 2717 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023787.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1329 bp

atgattacgccactgcccatttcctcaaaccaatcttcgagcccagaagtggagctggctcaaatcccagtcttgtttcttgaacatgctaaaagaaacgagcttttcgatcgtatggtgagtatcagaaggaaaatccatgaaaacccagagctttgttatgaggaatttgaaaccagtaagcttatcagagctgaacttgaccggctgggcatcccttacagataccctttggctgaaaccggcgttgttggccttgttgggaccggtggtccgccctttgttgcaatcagagcagacatggatgctttggctatgcaggagagtgtggagtgggagcacaagagtaaaattccagggaagatgcatggatgtggacatgatgctcatgttgccatgcttcttggagctgcaactatacttcaagagtatcgccacaaattacaggggactgttgttcttgttttccaaccagctgaggaaggaggtgcaggagcaaagaaaatgatagatgaaggtgcagtggagcatgtcagtgccatctttgggttacatgtcgctgctgaccaccccattggttcagtggccaccaggcctggccctattttggctgcgagtggattttttgaagccgtaataagtgggaagggaggtcatgctgcaattccacagcacacaatagacccaatattggctgcttccaatgttattgttagtctgcaacatcttgtttcacgtgaagccgaccccttggattcacaggttgtgactgttggaaaattccacggaggtggtgcatttaatgttattccggattctgttacaattggtggtactttcagggcattttcaaaggacagctttatccaacttaaacaaagaatcgaagaggttattactagacaagccagtgttcagaggtgcaatgcaaccgtcttattcaatgaaattgcacagcccttttaccctgcaactgtaaatgacaaagatttgcatgagtacttccggaaagttgcagtcgatttggtgggccctcagaatgtatttgagaagcaaccactgatgggggcggaagacttctcattctatcaagaagtaattccagggtacttcttctttctgggtatgaagaatgacactcaaggacagttcaaaccaatgcattcaccatatttcagagtaaacgaagacgtgcttccttatggagctgcattccatgcatcactggccgccaggtacctcctggaaaagcaaccgaaatctacctcaacagcagaccaaaaaacgaaatccacttccatgaaagggaactttcatgatgaactatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005794 GO:0008150 GO:0008152 GO:0009850 GO:0009987 GO:0010178 GO:0010179 GO:0010817 GO:0012505 GO:0016787 GO:0016810 GO:0042445 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044424 GO:0044444 GO:0044464 GO:0065007 GO:0065008

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

M20_dimer Peptidase_M20

Protein Analysis

442

Amino Acids

48.49

Weight (kDa)

5.98

Isoelectric Point (pI)

33.81

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010736)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G56650 AT5G56650 AT5G56660
fragaria_vesca	FvH4_1g06730 FvH4_1g06730
malus_domestica	MD02G1072200.v1.1 MD15G1202000.v1.1
prunus_persica	Prupe.7G215300_v2.0.a1
pyrus_communis	pycom02g05620 pycom15g17930
rosa_chinensis	RchiOBHm_Chr2g0092471
rosa_laevigata	RLG00000016315
rosa_multiflora	Rmu_sc0004296.1_g000017 Rmu_sc0023787.1_g000002
rosa_roxburghii	Rroxscaffold_2G00149070
rosa_rugosa	Rorug02G0026900
rosa_samantha	Rh2AG072700 Rh2BG073200 Rh2CG074500
rosa_wichuraiana	Rw2G006020

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	1236
AccB1I	GGYRCC	1 cut(s)	1236
AccIII	TCCGGA	2 cut(s)	811, 1005
AciI	CCGC	3 cut(s)	275, 1070, 1230
AcoI	YGGCCR	2 cut(s)	585, 1227
AcsI	RAATTY	3 cut(s)	167, 351, 779
AcvI	CACGTG	1 cut(s)	737
AfaI	GTAC	4 cut(s)	835, 1001, 1109, 1238
AfiI	CCNNNNNNNGG	6 cut(s)	49, 546, 607, 691, 1064, 1305
AflIII	ACRYGT	1 cut(s)	553
AgeI	ACCGGT	1 cut(s)	266
AgsI	TTSAA	7 cut(s)	83, 173, 425, 629, 852, 943, 1153
AhdI	GACNNNNNGTC	1 cut(s)	270
AjiI	CACGTC	1 cut(s)	1192
AjnI	CCWGG	6 cut(s)	355, 590, 595, 1102, 1232, 1242
AleI	CACNNNNGTG	1 cut(s)	789
AluBI	AGCT	9 cut(s)	55, 103, 154, 184, 194, 410, 476, 861, 1208
AluI	AGCT	9 cut(s)	55, 103, 154, 184, 194, 410, 476, 861, 1208
Alw21I	GWGCWC	1 cut(s)	342
Aor13HI	TCCGGA	2 cut(s)	811, 1005
AoxI	GGCC	6 cut(s)	253, 585, 593, 598, 1030, 1227
ApaI	GGGCCC	1 cut(s)	1034
ApeKI	GCWGC	6 cut(s)	410, 560, 611, 659, 695, 1208
ApoI	RAATTY	3 cut(s)	167, 351, 779
AsiGI	ACCGGT	1 cut(s)	266
Asp700I	GAANNNNTTC	1 cut(s)	1098
Asp718I	GGTACC	1 cut(s)	1236
AspS9I	GGNCC	5 cut(s)	264, 272, 599, 1030, 1031
AsuHPI	GGTGA	2 cut(s)	130, 1158
AvaII	GGWCC	2 cut(s)	264, 272
BaeGI	GKGCMC	1 cut(s)	1034
BalI	TGGCCA	1 cut(s)	587
BanI	GGYRCC	1 cut(s)	1236
BanII	GRGCYC	2 cut(s)	44, 1034
BbrPI	CACGTG	1 cut(s)	737
BbsI	GAAGAC	2 cut(s)	1080, 1194
Bbv12I	GWGCWC	1 cut(s)	342
BbvCI	CCTCAGC	1 cut(s)	477
BbvI	GCAGC	6 cut(s)	397, 547, 598, 646, 682, 1195
BccI	CCATC	2 cut(s)	548, 1057
BceAI	ACGGC	1 cut(s)	617
BciT130I	CCWGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
BfaI	CTAG	1 cut(s)	900
BisI	GCNGC	7 cut(s)	411, 561, 612, 660, 696, 1209, 1230
BlsI	GCNGC	7 cut(s)	412, 562, 613, 661, 697, 1210, 1231
BmcAI	AGTACT	1 cut(s)	1001
Bme1390I	CCNGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
Bme18I	GGWCC	2 cut(s)	264, 272
BmeRI	GACNNNNNGTC	1 cut(s)	270
BmgBI	CACGTC	1 cut(s)	1192
BmgT120I	GGNCC	5 cut(s)	264, 272, 599, 1030, 1031
BmiI	GGNNCC	3 cut(s)	265, 1032, 1238
BmrFI	CCNGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
BmrI	ACTGGG	1 cut(s)	62
BmsI	GCATC	5 cut(s)	222, 295, 354, 373, 1229
BmuI	ACTGGG	1 cut(s)	62
BpiI	GAAGAC	2 cut(s)	1080, 1194
Bpu10I	CCTNAGC	1 cut(s)	477
BpuEI	CTTGAG	1 cut(s)	1125
BsaAI	YACGTR	1 cut(s)	737
BsaJI	CCNNGG	4 cut(s)	356, 750, 784, 1103
BsaWI	WCCGGW	3 cut(s)	266, 811, 1005
Bsc4I	CCNNNNNNNGG	6 cut(s)	49, 546, 607, 691, 1064, 1305
Bse118I	RCCGGY	3 cut(s)	204, 242, 266
Bse1I	ACTGG	4 cut(s)	68, 177, 909, 1230
Bse3DI	GCAATG	1 cut(s)	931
BseAI	TCCGGA	2 cut(s)	811, 1005
BseBI	CCWGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
BseDI	CCNNGG	4 cut(s)	356, 750, 784, 1103
BseGI	GGATG	3 cut(s)	213, 310, 377
BseLI	CCNNNNNNNGG	6 cut(s)	49, 546, 607, 691, 1064, 1305
BseMI	GCAATG	1 cut(s)	931
BseMII	CTCAG	2 cut(s)	468, 1049
BseNI	ACTGG	4 cut(s)	68, 177, 909, 1230
BseSI	GKGCMC	1 cut(s)	1034
BseXI	GCAGC	6 cut(s)	397, 547, 598, 646, 682, 1195
BseYI	CCCAGC	1 cut(s)	208
BsgI	GTGCAG	2 cut(s)	510, 540
Bsh1285I	CGRYCG	1 cut(s)	112
BshFI	GGCC	6 cut(s)	255, 587, 595, 600, 1032, 1229
BshNI	GGYRCC	1 cut(s)	1236
BshTI	ACCGGT	1 cut(s)	266
BsiEI	CGRYCG	1 cut(s)	112
BsiHKAI	GWGCWC	1 cut(s)	342
BsiSI	CCGG	5 cut(s)	205, 243, 267, 812, 1006
BslFI	GGGAC	2 cut(s)	277, 463
BslI	CCNNNNNNNGG	6 cut(s)	49, 546, 607, 691, 1064, 1305
BsmFI	GGGAC	2 cut(s)	277, 463
BsmI	GAATGC	2 cut(s)	1162, 1211
BsnI	GGCC	6 cut(s)	255, 587, 595, 600, 1032, 1229
Bsp120I	GGGCCC	1 cut(s)	1030
Bsp1286I	GDGCHC	3 cut(s)	44, 342, 1034
Bsp13I	TCCGGA	2 cut(s)	811, 1005
Bsp143I	GATC	1 cut(s)	109
BspACI	CCGC	3 cut(s)	275, 1070, 1230
BspANI	GGCC	6 cut(s)	255, 587, 595, 600, 1032, 1229
BspCNI	CTCAG	2 cut(s)	469, 1048
BspEI	TCCGGA	2 cut(s)	811, 1005
BspHI	TCATGA	1 cut(s)	1315
BspLI	GGNNCC	3 cut(s)	265, 1032, 1238
BspT107I	GGYRCC	1 cut(s)	1236
BsrDI	GCAATG	1 cut(s)	931
BsrFI	RCCGGY	3 cut(s)	204, 242, 266
BsrI	ACTGG	4 cut(s)	68, 177, 909, 1230
BssAI	RCCGGY	3 cut(s)	204, 242, 266
BssECI	CCNNGG	4 cut(s)	356, 750, 784, 1103
BssMI	GATC	1 cut(s)	109
BssT1I	CCWWGG	1 cut(s)	750
Bst2UI	CCWGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
Bst4CI	ACNGT	5 cut(s)	454, 772, 934, 976, 1149
Bst6I	CTCTTC	1 cut(s)	882
BstAPI	GCANNNNNTGC	1 cut(s)	1217
BstBAI	YACGTR	1 cut(s)	737
BstC8I	GCNNGC	1 cut(s)	57
BstDEI	CTNAG	2 cut(s)	477, 1035
BstDSI	CCRYGG	1 cut(s)	784
BstF5I	GGATG	3 cut(s)	213, 310, 377
BstKTI	GATC	1 cut(s)	112
BstMBI	GATC	1 cut(s)	109
BstMCI	CGRYCG	1 cut(s)	112
BstMWI	GCNNNNNNNGC	5 cut(s)	252, 293, 392, 1217, 1226
BstNI	CCWGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
BstNSI	RCATGY	3 cut(s)	89, 533, 557
BstSCI	CCNGG	6 cut(s)	355, 590, 595, 1102, 1232, 1242
BstSLI	GKGCMC	1 cut(s)	1034
BstV1I	GCAGC	6 cut(s)	397, 547, 598, 646, 682, 1195
BstV2I	GAAGAC	2 cut(s)	1080, 1194
BstXI	CCANNNNNNTGG	2 cut(s)	575, 791
BsuRI	GGCC	6 cut(s)	255, 587, 595, 600, 1032, 1229
BtgI	CCRYGG	1 cut(s)	784
BtrI	CACGTC	1 cut(s)	1192
BtsCI	GGATG	3 cut(s)	213, 310, 377
BtsI	GCAGTG	2 cut(s)	11, 528
BtsIMutI	CAGTG	7 cut(s)	11, 528, 541, 588, 916, 1058, 1223
Cac8I	GCNNGC	1 cut(s)	57
CciI	TCATGA	1 cut(s)	1315
Cfr10I	RCCGGY	3 cut(s)	204, 242, 266
Cfr13I	GGNCC	5 cut(s)	264, 272, 599, 1030, 1031
Csp6I	GTAC	4 cut(s)	834, 1000, 1108, 1237
CspAI	ACCGGT	1 cut(s)	266
CviQI	GTAC	4 cut(s)	834, 1000, 1108, 1237
DdeI	CTNAG	2 cut(s)	477, 1035
DpnI	GATC	1 cut(s)	111
DpnII	GATC	1 cut(s)	109
DriI	GACNNNNNGTC	1 cut(s)	270
EaeI	YGGCCR	2 cut(s)	585, 1227
Eam1104I	CTCTTC	1 cut(s)	882
Eam1105I	GACNNNNNGTC	1 cut(s)	270
EarI	CTCTTC	1 cut(s)	882
EciI	GGCGGA	2 cut(s)	264, 1085
Eco130I	CCWWGG	1 cut(s)	750
Eco147I	AGGCCT	1 cut(s)	595
Eco24I	GRGCYC	2 cut(s)	44, 1034
Eco47I	GGWCC	2 cut(s)	264, 272
Eco72I	CACGTG	1 cut(s)	737
EcoO109I	RGGNCCY	1 cut(s)	1031
EcoRII	CCWGG	6 cut(s)	355, 590, 595, 1102, 1232, 1242
EcoT14I	CCWWGG	1 cut(s)	750
EcoT22I	ATGCAT	3 cut(s)	369, 1164, 1222
EcoT38I	GRGCYC	2 cut(s)	44, 1034
ErhI	CCWWGG	1 cut(s)	750
FalI	AAGNNNNNCTT	4 cut(s)	845, 877, 1179, 1211
FaqI	GGGAC	2 cut(s)	277, 463
Fnu4HI	GCNGC	7 cut(s)	411, 561, 612, 660, 696, 1209, 1230
FokI	GGATG	3 cut(s)	200, 317, 384
FriOI	GRGCYC	2 cut(s)	44, 1034
Fsp4HI	GCNGC	7 cut(s)	411, 561, 612, 660, 696, 1209, 1230
FspBI	CTAG	1 cut(s)	900
GluI	GCNGC	7 cut(s)	411, 561, 612, 660, 696, 1209, 1230
GsaI	CCCAGC	1 cut(s)	212
HaeIII	GGCC	6 cut(s)	255, 587, 595, 600, 1032, 1229
HapII	CCGG	5 cut(s)	205, 243, 267, 812, 1006
HindIII	AAGCTT	1 cut(s)	182
HinfI	GANTC	3 cut(s)	755, 815, 882
HpaII	CCGG	5 cut(s)	205, 243, 267, 812, 1006
HphI	GGTGA	2 cut(s)	130, 1158
Hpy166II	GTNNAC	2 cut(s)	377, 1183
Hpy188I	TCNGA	6 cut(s)	128, 191, 293, 918, 1038, 1178
Hpy188III	TCNNGA	6 cut(s)	80, 425, 812, 1006, 1091, 1316
Hpy8I	GTNNAC	2 cut(s)	377, 1183
HpyAV	CCTTC	4 cut(s)	123, 476, 509, 640
HpyCH4III	ACNGT	5 cut(s)	454, 772, 934, 976, 1149
HpyCH4IV	ACGT	2 cut(s)	736, 1191
HpyF10VI	GCNNNNNNNGC	5 cut(s)	252, 293, 392, 1217, 1226
HpyF3I	CTNAG	2 cut(s)	477, 1035
HpySE526I	ACGT	2 cut(s)	736, 1191
Kpn2I	TCCGGA	2 cut(s)	811, 1005
KpnI	GGTACC	1 cut(s)	1240
Kzo9I	GATC	1 cut(s)	109
LmnI	GCTCC	6 cut(s)	52, 337, 407, 494, 526, 1205
Lsp1109I	GCAGC	6 cut(s)	397, 547, 598, 646, 682, 1195
LweI	GCATC	5 cut(s)	222, 295, 354, 373, 1229
MaeI	CTAG	1 cut(s)	900
MaeII	ACGT	2 cut(s)	736, 1191
MaeIII	GTNAC	3 cut(s)	549, 766, 820
MalI	GATC	1 cut(s)	111
MboI	GATC	1 cut(s)	109
MboII	GAAGA	7 cut(s)	27, 373, 899, 1085, 1105, 1141, 1199
MfeI	CAATTG	1 cut(s)	825
MhlI	GDGCHC	3 cut(s)	44, 342, 1034
MlsI	TGGCCA	1 cut(s)	587
MluCI	AATT	8 cut(s)	167, 351, 440, 663, 779, 825, 948, 1098
MluNI	TGGCCA	1 cut(s)	587
MmeI	TCCRAC	3 cut(s)	493, 754, 892
Mox20I	TGGCCA	1 cut(s)	587
Mph1103I	ATGCAT	3 cut(s)	369, 1164, 1222
MroI	TCCGGA	2 cut(s)	811, 1005
MroXI	GAANNNNTTC	1 cut(s)	1098
MscI	TGGCCA	1 cut(s)	587
MseI	TTAA	2 cut(s)	801, 873
MslI	CAYNNNNRTG	4 cut(s)	372, 534, 789, 1298
Msp20I	TGGCCA	1 cut(s)	587
MspA1I	CMGCKG	1 cut(s)	476
MspI	CCGG	5 cut(s)	205, 243, 267, 812, 1006
MspR9I	CCNGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
MunI	CAATTG	1 cut(s)	825
Mva1269I	GAATGC	2 cut(s)	1162, 1211
MvaI	CCWGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
MwoI	GCNNNNNNNGC	5 cut(s)	252, 293, 392, 1217, 1226
NdeII	GATC	1 cut(s)	109
NlaIV	GGNNCC	3 cut(s)	265, 1032, 1238
NmuCI	GTSAC	1 cut(s)	766
NsiI	ATGCAT	3 cut(s)	369, 1164, 1222
NspI	RCATGY	3 cut(s)	89, 533, 557
OliI	CACNNNNGTG	1 cut(s)	789
PagI	TCATGA	1 cut(s)	1315
PceI	AGGCCT	1 cut(s)	595
PciI	ACATGT	1 cut(s)	553
PcsI	WCGNNNNNNNCGW	1 cut(s)	105
PctI	GAATGC	2 cut(s)	1162, 1211
PdmI	GAANNNNTTC	1 cut(s)	1098
PfeI	GAWTC	3 cut(s)	755, 815, 882
PfoI	TCCNGGA	1 cut(s)	1242
PinAI	ACCGGT	1 cut(s)	266
PkrI	GCNGC	7 cut(s)	412, 562, 613, 661, 697, 1210, 1231
Ple19I	CGATCG	1 cut(s)	112
PmaCI	CACGTG	1 cut(s)	737
PmlI	CACGTG	1 cut(s)	737
Ppu21I	YACGTR	1 cut(s)	737
PscI	ACATGT	1 cut(s)	553
Psp6I	CCWGG	6 cut(s)	355, 590, 595, 1102, 1232, 1242
PspCI	CACGTG	1 cut(s)	737
PspFI	CCCAGC	1 cut(s)	208
PspGI	CCWGG	6 cut(s)	355, 590, 595, 1102, 1232, 1242
PspN4I	GGNNCC	3 cut(s)	265, 1032, 1238
PspOMI	GGGCCC	1 cut(s)	1030
PspPI	GGNCC	5 cut(s)	264, 272, 599, 1030, 1031
PvuI	CGATCG	1 cut(s)	112
PvuII	CAGCTG	1 cut(s)	476
RsaI	GTAC	4 cut(s)	835, 1001, 1109, 1238
RsaNI	GTAC	4 cut(s)	834, 1000, 1108, 1237
RseI	CAYNNNNRTG	4 cut(s)	372, 534, 789, 1298
SaqAI	TTAA	2 cut(s)	801, 873
SatI	GCNGC	7 cut(s)	411, 561, 612, 660, 696, 1209, 1230
Sau3AI	GATC	1 cut(s)	109
Sau96I	GGNCC	5 cut(s)	264, 272, 599, 1030, 1031
ScaI	AGTACT	1 cut(s)	1001
ScrFI	CCNGG	6 cut(s)	357, 592, 597, 1104, 1234, 1244
SduI	GDGCHC	3 cut(s)	44, 342, 1034
SfaNI	GCATC	5 cut(s)	222, 295, 354, 373, 1229
SinI	GGWCC	2 cut(s)	264, 272
SmiMI	CAYNNNNRTG	4 cut(s)	372, 534, 789, 1298
SmlI	CTYRAG	1 cut(s)	1140
SmoI	CTYRAG	1 cut(s)	1140
Sse9I	AATT	8 cut(s)	167, 351, 440, 663, 779, 825, 948, 1098
SseBI	AGGCCT	1 cut(s)	595
SsiI	CCGC	3 cut(s)	275, 1070, 1230
SspI	AATATT	1 cut(s)	690
SspMI	CTAG	1 cut(s)	900
StuI	AGGCCT	1 cut(s)	595
StyD4I	CCNGG	6 cut(s)	355, 590, 595, 1102, 1232, 1242
StyI	CCWWGG	1 cut(s)	750
TaaI	ACNGT	5 cut(s)	454, 772, 934, 976, 1149
TaiI	ACGT	2 cut(s)	739, 1194
TaqI	TCGA	4 cut(s)	38, 108, 885, 1020
TasI	AATT	8 cut(s)	167, 351, 440, 663, 779, 825, 948, 1098
TatI	WGTACW	1 cut(s)	999
TauI	GCSGC	1 cut(s)	1232
TfiI	GAWTC	3 cut(s)	755, 815, 882
Tru1I	TTAA	2 cut(s)	801, 873
Tru9I	TTAA	2 cut(s)	801, 873
TscAI	CASTG	7 cut(s)	18, 528, 541, 588, 916, 1065, 1230
TseFI	GTSAC	1 cut(s)	766
TseI	GCWGC	6 cut(s)	410, 560, 611, 659, 695, 1208
Tsp45I	GTSAC	1 cut(s)	766
TspDTI	ATGAA	6 cut(s)	156, 528, 960, 1142, 1304, 1316
TspGWI	ACGGA	1 cut(s)	801
TspRI	CASTG	7 cut(s)	18, 528, 541, 588, 916, 1065, 1230
VpaK11BI	GGWCC	2 cut(s)	264, 272
XapI	RAATTY	3 cut(s)	167, 351, 779
XceI	RCATGY	3 cut(s)	89, 533, 557
XcmI	CCANNNNNNNNNTGG	2 cut(s)	580, 1240
XmnI	GAANNNNTTC	1 cut(s)	1098
XspI	CTAG	1 cut(s)	900
ZrmI	AGTACT	1 cut(s)	1001
Zsp2I	ATGCAT	3 cut(s)	369, 1164, 1222

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.