Rmu_sc0026264.1_g000001

Leucine-rich repeat receptor protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026264.1
Physical Location & Seq
Forward (+)
1 .. 582
582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026264.1_g000001.1.cds

Sequence Viewer

Length: 582 bp
aacttccttactggtgaattgccgctttcattgggaaatctgtcatacttgacatatttggatcttcatgcaaatttgtttaggggaaagattcctccagaccttgggaatctggtgcaacttgagtactttgatgtttctagtaaccggctatctggacagattcctgagaaagtatgcaacctcaccagtctggtttacttgaatttggcagaaaatggtttggaagggtcgattcccaggagtggtatttgcagggacctttcaaaagtatctgttgttggtaatagaaaattgtgtgggagaagttcgaatttagattgccgagtcaaaagcttagacaaatcagctgtgctgaatgcctggggactcgcagcaattgtcgttggaagtgctctgatctctcttgcagcggtcgtgggtctgatcagatgggttacaagaagtagccggcaaaacgatcttgaagaaagcgaggacagcaagctcaagagtttcatcgatcatcatctctatttcctgggtaacagccaaccaaaggagcctctgagcatcaatatggccatgtttgagcagcctctt

Protein Analysis

194

Amino Acids

21.29

Weight (kDa)

7.01

Isoelectric Point (pI)

26.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012974)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 104
AciI CCGC 2 cut(s) 23, 413
AclWI GGATC 1 cut(s) 69
AcoI YGGCCR 1 cut(s) 561
AcsI RAATTY 3 cut(s) 73, 205, 313
AfaI GTAC 1 cut(s) 128
AfiI CCNNNNNNNGG 3 cut(s) 104, 245, 538
AgsI TTSAA 3 cut(s) 205, 267, 467
AjnI CCWGG 3 cut(s) 239, 362, 519
AluBI AGCT 3 cut(s) 336, 350, 487
AluI AGCT 3 cut(s) 336, 350, 487
Alw21I GWGCWC 1 cut(s) 397
AlwI GGATC 1 cut(s) 69
AoxI GGCC 1 cut(s) 561
ApeKI GCWGC 3 cut(s) 374, 410, 574
ApoI RAATTY 3 cut(s) 73, 205, 313
AspS9I GGNCC 1 cut(s) 259
AsuHPI GGTGA 2 cut(s) 26, 178
AsuII TTCGAA 1 cut(s) 311
AvaII GGWCC 1 cut(s) 259
BalI TGGCCA 1 cut(s) 563
Bbv12I GWGCWC 1 cut(s) 397
BbvI GCAGC 2 cut(s) 386, 422
BccI CCATC 1 cut(s) 426
BciT130I CCWGG 3 cut(s) 241, 364, 521
BclI TGATCA 1 cut(s) 426
BfaI CTAG 1 cut(s) 141
BisI GCNGC 4 cut(s) 23, 375, 411, 575
BlsI GCNGC 4 cut(s) 24, 376, 412, 576
BmcAI AGTACT 1 cut(s) 128
Bme1390I CCNGG 3 cut(s) 241, 364, 521
Bme18I GGWCC 1 cut(s) 259
BmgT120I GGNCC 1 cut(s) 259
BmiI GGNNCC 2 cut(s) 260, 543
BmrFI CCNGG 3 cut(s) 241, 364, 521
BmsI GCATC 1 cut(s) 561
BpmI CTGGAG 1 cut(s) 81
Bpu14I TTCGAA 1 cut(s) 311
BpuEI CTTGAG 2 cut(s) 143, 473
Bsa29I ATCGAT 1 cut(s) 501
BsaBI GATNNNNATC 1 cut(s) 507
BsaJI CCNNGG 4 cut(s) 103, 239, 363, 520
Bsc4I CCNNNNNNNGG 3 cut(s) 104, 245, 538
Bse118I RCCGGY 2 cut(s) 147, 450
Bse1I ACTGG 2 cut(s) 16, 189
Bse8I GATNNNNATC 1 cut(s) 507
BseBI CCWGG 3 cut(s) 241, 364, 521
BseCI ATCGAT 1 cut(s) 501
BseDI CCNNGG 4 cut(s) 103, 239, 363, 520
BseJI GATNNNNATC 1 cut(s) 507
BseLI CCNNNNNNNGG 3 cut(s) 104, 245, 538
BseMII CTCAG 2 cut(s) 159, 539
BseNI ACTGG 2 cut(s) 16, 189
BseXI GCAGC 2 cut(s) 386, 422
Bsh1285I CGRYCG 1 cut(s) 417
BshFI GGCC 1 cut(s) 563
BshVI ATCGAT 1 cut(s) 501
BsiEI CGRYCG 1 cut(s) 417
BsiHKAI GWGCWC 1 cut(s) 397
BsiSI CCGG 2 cut(s) 148, 451
BslFI GGGAC 2 cut(s) 272, 381
BslI CCNNNNNNNGG 3 cut(s) 104, 245, 538
BsmFI GGGAC 2 cut(s) 272, 381
BsmI GAATGC 1 cut(s) 364
BsnI GGCC 1 cut(s) 563
Bsp119I TTCGAA 1 cut(s) 311
Bsp1286I GDGCHC 1 cut(s) 397
Bsp143I GATC 5 cut(s) 61, 399, 426, 460, 502
BspACI CCGC 2 cut(s) 23, 413
BspANI GGCC 1 cut(s) 563
BspCNI CTCAG 2 cut(s) 160, 540
BspDI ATCGAT 1 cut(s) 501
BspLI GGNNCC 2 cut(s) 260, 543
BspPI GGATC 1 cut(s) 69
BspT104I TTCGAA 1 cut(s) 311
BsrFI RCCGGY 2 cut(s) 147, 450
BsrI ACTGG 2 cut(s) 16, 189
BssAI RCCGGY 2 cut(s) 147, 450
BssECI CCNNGG 4 cut(s) 103, 239, 363, 520
BssMI GATC 5 cut(s) 61, 399, 426, 460, 502
BssT1I CCWWGG 1 cut(s) 103
Bst2UI CCWGG 3 cut(s) 241, 364, 521
BstBI TTCGAA 1 cut(s) 311
BstC8I GCNNGC 2 cut(s) 452, 485
BstDEI CTNAG 3 cut(s) 168, 337, 548
BstKTI GATC 5 cut(s) 64, 402, 429, 463, 505
BstMBI GATC 5 cut(s) 61, 399, 426, 460, 502
BstMCI CGRYCG 1 cut(s) 417
BstMWI GCNNNNNNNGC 1 cut(s) 480
BstNI CCWGG 3 cut(s) 241, 364, 521
BstSCI CCNGG 3 cut(s) 239, 362, 519
BstV1I GCAGC 2 cut(s) 386, 422
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
Bsu15I ATCGAT 1 cut(s) 501
BsuRI GGCC 1 cut(s) 563
BsuTUI ATCGAT 1 cut(s) 501
Cac8I GCNNGC 2 cut(s) 452, 485
Cfr10I RCCGGY 2 cut(s) 147, 450
Cfr13I GGNCC 1 cut(s) 259
ClaI ATCGAT 1 cut(s) 501
Csp6I GTAC 1 cut(s) 127
CviAII CATG 2 cut(s) 68, 565
CviJI RGCY 9 cut(s) 151, 336, 350, 450, 487, 531, 544, 563, 577
CviKI_1 RGCY 9 cut(s) 151, 336, 350, 450, 487, 531, 544, 563, 577
CviQI GTAC 1 cut(s) 127
DdeI CTNAG 3 cut(s) 168, 337, 548
DpnI GATC 5 cut(s) 63, 401, 428, 462, 504
DpnII GATC 5 cut(s) 61, 399, 426, 460, 502
EaeI YGGCCR 1 cut(s) 561
Eco130I CCWWGG 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 259
EcoO109I RGGNCCY 1 cut(s) 259
EcoRII CCWGG 3 cut(s) 239, 362, 519
EcoT14I CCWWGG 1 cut(s) 103
ErhI CCWWGG 1 cut(s) 103
FaeI CATG 2 cut(s) 71, 568
FaiI YATR 6 cut(s) 46, 55, 69, 178, 560, 566
FaqI GGGAC 2 cut(s) 272, 381
FatI CATG 2 cut(s) 67, 564
FbaI TGATCA 1 cut(s) 426
Fnu4HI GCNGC 4 cut(s) 23, 375, 411, 575
Fsp4HI GCNGC 4 cut(s) 23, 375, 411, 575
FspBI CTAG 1 cut(s) 141
GluI GCNGC 4 cut(s) 23, 375, 411, 575
GsuI CTGGAG 1 cut(s) 81
HaeIII GGCC 1 cut(s) 563
HapII CCGG 2 cut(s) 148, 451
Hin1II CATG 2 cut(s) 71, 568
HindIII AAGCTT 1 cut(s) 334
HinfI GANTC 6 cut(s) 91, 109, 163, 235, 327, 369
HpaII CCGG 2 cut(s) 148, 451
HphI GGTGA 2 cut(s) 26, 178
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 4 cut(s) 399, 426, 431, 549
Hpy188III TCNNGA 5 cut(s) 98, 156, 167, 464, 490
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 221
HpyCH4V TGCA 5 cut(s) 71, 118, 180, 255, 410
HpyF10VI GCNNNNNNNGC 1 cut(s) 480
HpyF3I CTNAG 3 cut(s) 168, 337, 548
Hsp92II CATG 2 cut(s) 71, 568
KroI GCCGGC 1 cut(s) 450
KroNI GCCGGC 1 cut(s) 452
Ksp22I TGATCA 1 cut(s) 426
Kzo9I GATC 5 cut(s) 61, 399, 426, 460, 502
LmnI GCTCC 1 cut(s) 541
Lsp1109I GCAGC 2 cut(s) 386, 422
LweI GCATC 1 cut(s) 561
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 3 cut(s) 143, 436, 524
MalI GATC 5 cut(s) 63, 401, 428, 462, 504
MboI GATC 5 cut(s) 61, 399, 426, 460, 502
MboII GAAGA 2 cut(s) 56, 479
MfeI CAATTG 1 cut(s) 378
MflI RGATCY 1 cut(s) 61
MhlI GDGCHC 1 cut(s) 397
MlsI TGGCCA 1 cut(s) 563
MluCI AATT 6 cut(s) 17, 73, 205, 293, 313, 378
MluNI TGGCCA 1 cut(s) 563
MlyI GAGTC 2 cut(s) 336, 363
MmeI TCCRAC 1 cut(s) 367
MnlI CCTC 4 cut(s) 105, 194, 469, 555
Mox20I TGGCCA 1 cut(s) 563
MroNI GCCGGC 1 cut(s) 450
MscI TGGCCA 1 cut(s) 563
MslI CAYNNNNRTG 1 cut(s) 557
Msp20I TGGCCA 1 cut(s) 563
MspA1I CMGCKG 2 cut(s) 350, 413
MspI CCGG 2 cut(s) 148, 451
MspR9I CCNGG 3 cut(s) 241, 364, 521
MunI CAATTG 1 cut(s) 378
Mva1269I GAATGC 1 cut(s) 364
MvaI CCWGG 3 cut(s) 241, 364, 521
MwoI GCNNNNNNNGC 1 cut(s) 480
NaeI GCCGGC 1 cut(s) 452
NdeII GATC 5 cut(s) 61, 399, 426, 460, 502
NgoMIV GCCGGC 1 cut(s) 450
NlaIII CATG 2 cut(s) 71, 568
NlaIV GGNNCC 2 cut(s) 260, 543
NmeAIII GCCGAG 1 cut(s) 350
NspV TTCGAA 1 cut(s) 311
PctI GAATGC 1 cut(s) 364
PdiI GCCGGC 1 cut(s) 452
PfeI GAWTC 4 cut(s) 91, 109, 163, 235
PflMI CCANNNNNTGG 1 cut(s) 104
PkrI GCNGC 4 cut(s) 24, 376, 412, 576
PleI GAGTC 2 cut(s) 335, 363
PpsI GAGTC 2 cut(s) 335, 363
PpuMI RGGWCCY 1 cut(s) 259
Psp5II RGGWCCY 1 cut(s) 259
Psp6I CCWGG 3 cut(s) 239, 362, 519
PspGI CCWGG 3 cut(s) 239, 362, 519
PspN4I GGNNCC 2 cut(s) 260, 543
PspPI GGNCC 1 cut(s) 259
PspPPI RGGWCCY 1 cut(s) 259
PsuI RGATCY 1 cut(s) 61
PvuII CAGCTG 1 cut(s) 350
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 557
SatI GCNGC 4 cut(s) 23, 375, 411, 575
Sau3AI GATC 5 cut(s) 61, 399, 426, 460, 502
Sau96I GGNCC 1 cut(s) 259
ScaI AGTACT 1 cut(s) 128
SchI GAGTC 2 cut(s) 336, 363
ScrFI CCNGG 3 cut(s) 241, 364, 521
SduI GDGCHC 1 cut(s) 397
SetI ASST 6 cut(s) 105, 186, 264, 338, 352, 489
SfaNI GCATC 1 cut(s) 561
SfuI TTCGAA 1 cut(s) 311
SinI GGWCC 1 cut(s) 259
SmiMI CAYNNNNRTG 1 cut(s) 557
SmlI CTYRAG 2 cut(s) 122, 488
SmoI CTYRAG 2 cut(s) 122, 488
Sse9I AATT 6 cut(s) 17, 73, 205, 293, 313, 378
SsiI CCGC 2 cut(s) 23, 413
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 3 cut(s) 239, 362, 519
StyI CCWWGG 1 cut(s) 103
TaqI TCGA 3 cut(s) 233, 311, 501
TasI AATT 6 cut(s) 17, 73, 205, 293, 313, 378
TatI WGTACW 1 cut(s) 126
TauI GCSGC 1 cut(s) 25
TfiI GAWTC 4 cut(s) 91, 109, 163, 235
TseI GCWGC 3 cut(s) 374, 410, 574
TspDTI ATGAA 3 cut(s) 18, 56, 487
Van91I CCANNNNNTGG 1 cut(s) 104
VpaK11BI GGWCC 1 cut(s) 259
XapI RAATTY 3 cut(s) 73, 205, 313
XspI CTAG 1 cut(s) 141
ZrmI AGTACT 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.