Rmu_sc0026423.1_g000001

Plant protein of unknown function (DUF936)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0026423.1
OG0011337
Physical Location & Seq
Forward (+)
1 .. 1125
1125 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0026423.1_g000001.1.cds

Sequence Viewer

Length: 944 bp
atgcacaaaccccacaaaagacctccaattcaaagccacagcaaccccagtctgctaatgtgtcgaatgacagcaacagcaacagcactagtctctgtctttctatgaacttacccggaaaactcagcacgcttggaaaagaagctgtgcagcagcgagagacagctcagaagattgccctcaatgcactgagagatgcttcggctactgaggccttagtccgatcactcaagactttttcaaacttgtgcaaagcagcaaaagcagatgccccagcagcctgctttgatcaatttctcgaattccatcagcaagttgtccaagcagtggcggaaatggtctcagttcaagcagctacttcagctgctcaaacaccaaatgctaagcagcagagagacaaagaagaagaagaagatgcagtgttaaacgaaatggttcacaactccatgaactcgaaattgagcttatcgaaaagaaggtgcgctttgtacaagtcagttgcaaccattcccgaaagaggtgagctgaagacaagcttcgagaaacagctgagagcctctagtaatcagaaggaaaggaagacaccatccactccccttggaaggctgaatcttgaaaccattggcgagaatgatgagaacaagaaaccaccagctgtttcttcgaactcttgcagcttaaccaatacaatcaaattggggaagcagattgaaacagaagctgggaactggtttatggaattcttggagaagactttggagaaaggcatgaagaaaacaaaaggcacaacaacggatggggatgtgcgaaaagtaccccagtctttgatacttagagtgattaattgggtggaaatacaacaatgtgatagcaataagcgaccagtacatcccaaggcagcacaagtagccagaaagttgaggatcaagatgaagaatccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF936

Protein Analysis

313

Amino Acids

34.48

Weight (kDa)

9.53

Isoelectric Point (pI)

43.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011337)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G23790 AT1G70340
fragaria_vesca FvH4_4g34410 FvH4_4g34410
malus_domestica MD13G1091800.v1.1 MD16G1092400.v1.1
prunus_persica Prupe.1G254000_v2.0.a1
pyrus_communis pycom13g07970 pycom16g07880
rosa_chinensis RchiOBHm_Chr4g0443831
rosa_laevigata RLG00000005884
rosa_multiflora Rmu_sc0005632.1_g000006 Rmu_sc0026423.1_g000001
rosa_roxburghii Rroxscaffold_5G00384400
rosa_rugosa Rorug04G0347700
rosa_samantha Rh4AG407900 Rh4BG418900 Rh4CG433000 Rh4DG414100
rosa_wichuraiana Rw4G035030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 327
AciI CCGC 1 cut(s) 331
AclWI GGATC 1 cut(s) 931
AcsI RAATTY 2 cut(s) 301, 739
AcuI CTGAAG 2 cut(s) 344, 547
AfaI GTAC 3 cut(s) 490, 815, 887
AfiI CCNNNNNNNGG 3 cut(s) 327, 517, 602
AgsI TTSAA 5 cut(s) 32, 242, 349, 616, 712
AhlI ACTAGT 1 cut(s) 88
Alw26I GTCTC 4 cut(s) 97, 154, 345, 389
AlwI GGATC 1 cut(s) 931
AlwNI CAGNNNCTG 1 cut(s) 721
AoxI GGCC 1 cut(s) 212
ApeKI GCWGC 9 cut(s) 150, 153, 256, 277, 352, 364, 387, 674, 898
ApoI RAATTY 2 cut(s) 301, 739
AseI ATTAAT 1 cut(s) 842
Asp700I GAANNNNTTC 1 cut(s) 434
AspLEI GCGC 1 cut(s) 484
AsuC2I CCSGG 1 cut(s) 116
AsuHPI GGTGA 1 cut(s) 532
AsuII TTCGAA 1 cut(s) 664
BbsI GAAGAC 3 cut(s) 535, 586, 757
BbvI GCAGC 9 cut(s) 162, 165, 268, 289, 351, 364, 399, 686, 910
BccI CCATC 3 cut(s) 314, 594, 790
BclI TGATCA 1 cut(s) 288
BcnI CCSGG 1 cut(s) 116
BcoDI GTCTC 4 cut(s) 97, 154, 345, 389
BcuI ACTAGT 1 cut(s) 88
BfaI CTAG 2 cut(s) 89, 560
BisI GCNGC 9 cut(s) 151, 154, 257, 278, 353, 365, 388, 675, 899
BlpI GCTNAGC 1 cut(s) 383
BlsI GCNGC 9 cut(s) 152, 155, 258, 279, 354, 366, 389, 676, 900
Bme1390I CCNGG 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 116
BmrI ACTGGG 2 cut(s) 42, 813
BmsI GCATC 3 cut(s) 186, 258, 405
BmuI ACTGGG 2 cut(s) 42, 813
BpiI GAAGAC 3 cut(s) 535, 586, 757
Bpu1102I GCTNAGC 1 cut(s) 383
Bpu14I TTCGAA 1 cut(s) 664
BpuEI CTTGAG 1 cut(s) 214
BpuMI CCSGG 1 cut(s) 116
BsaI GGTCTC 1 cut(s) 345
BsaJI CCNNGG 2 cut(s) 597, 893
Bsc4I CCNNNNNNNGG 3 cut(s) 327, 517, 602
Bse1I ACTGG 4 cut(s) 48, 733, 819, 883
BseDI CCNNGG 2 cut(s) 597, 893
BseGI GGATG 4 cut(s) 586, 801, 807, 888
BseLI CCNNNNNNNGG 3 cut(s) 327, 517, 602
BseMII CTCAG 6 cut(s) 138, 181, 181, 200, 356, 541
BseNI ACTGG 4 cut(s) 48, 733, 819, 883
BseXI GCAGC 9 cut(s) 162, 165, 268, 289, 351, 364, 399, 686, 910
BseYI CCCAGC 2 cut(s) 273, 721
BsgI GTGCAG 1 cut(s) 169
BshFI GGCC 1 cut(s) 214
BsiSI CCGG 1 cut(s) 116
BslI CCNNNNNNNGG 3 cut(s) 327, 517, 602
BsmAI GTCTC 4 cut(s) 97, 154, 345, 389
BsnI GGCC 1 cut(s) 214
Bso31I GGTCTC 1 cut(s) 345
Bsp119I TTCGAA 1 cut(s) 664
Bsp1407I TGTACA 1 cut(s) 488
Bsp143I GATC 3 cut(s) 223, 288, 923
Bsp1720I GCTNAGC 1 cut(s) 383
BspACI CCGC 1 cut(s) 331
BspANI GGCC 1 cut(s) 214
BspCNI CTCAG 6 cut(s) 137, 180, 182, 201, 355, 542
BspPI GGATC 1 cut(s) 931
BspT104I TTCGAA 1 cut(s) 664
BspTNI GGTCTC 1 cut(s) 345
BsrGI TGTACA 1 cut(s) 488
BsrI ACTGG 4 cut(s) 48, 733, 819, 883
BssECI CCNNGG 2 cut(s) 597, 893
BssMI GATC 3 cut(s) 223, 288, 923
BssT1I CCWWGG 2 cut(s) 597, 893
BstAUI TGTACA 1 cut(s) 488
BstBI TTCGAA 1 cut(s) 664
BstC8I GCNNGC 2 cut(s) 130, 282
BstDEI CTNAG 9 cut(s) 124, 167, 190, 209, 216, 342, 383, 550, 832
BstF5I GGATG 4 cut(s) 586, 801, 807, 888
BstHHI GCGC 1 cut(s) 484
BstKTI GATC 3 cut(s) 226, 291, 926
BstMAI GTCTC 4 cut(s) 97, 154, 345, 389
BstMBI GATC 3 cut(s) 223, 288, 923
BstMWI GCNNNNNNNGC 6 cut(s) 184, 211, 262, 277, 361, 907
BstSCI CCNGG 1 cut(s) 114
BstV1I GCAGC 9 cut(s) 162, 165, 268, 289, 351, 364, 399, 686, 910
BstV2I GAAGAC 3 cut(s) 535, 586, 757
BsuRI GGCC 1 cut(s) 214
BtsCI GGATG 4 cut(s) 586, 801, 807, 888
BtsI GCAGTG 2 cut(s) 332, 425
BtsIMutI CAGTG 3 cut(s) 187, 332, 425
Cac8I GCNNGC 2 cut(s) 130, 282
CaiI CAGNNNCTG 1 cut(s) 721
CfoI GCGC 1 cut(s) 484
Csp6I GTAC 3 cut(s) 489, 814, 886
CspCI CAANNNNNGTGG 2 cut(s) 579, 614
CviAII CATG 2 cut(s) 447, 768
CviQI GTAC 3 cut(s) 489, 814, 886
DdeI CTNAG 9 cut(s) 124, 167, 190, 209, 216, 342, 383, 550, 832
DpnI GATC 3 cut(s) 225, 290, 925
DpnII GATC 3 cut(s) 223, 288, 923
EciI GGCGGA 1 cut(s) 346
Eco130I CCWWGG 2 cut(s) 597, 893
Eco147I AGGCCT 1 cut(s) 214
Eco31I GGTCTC 1 cut(s) 345
Eco57I CTGAAG 2 cut(s) 344, 547
EcoRI GAATTC 2 cut(s) 301, 739
EcoT14I CCWWGG 2 cut(s) 597, 893
ErhI CCWWGG 2 cut(s) 597, 893
FaeI CATG 2 cut(s) 450, 771
FaiI YATR 4 cut(s) 106, 448, 736, 769
FalI AAGNNNNNCTT 4 cut(s) 468, 500, 520, 552
FatI CATG 2 cut(s) 446, 767
FbaI TGATCA 1 cut(s) 288
Fnu4HI GCNGC 9 cut(s) 151, 154, 257, 278, 353, 365, 388, 675, 899
FokI GGATG 4 cut(s) 573, 808, 814, 875
Fsp4HI GCNGC 9 cut(s) 151, 154, 257, 278, 353, 365, 388, 675, 899
FspBI CTAG 2 cut(s) 89, 560
GlaI GCGC 1 cut(s) 483
GluI GCNGC 9 cut(s) 151, 154, 257, 278, 353, 365, 388, 675, 899
GsaI CCCAGC 2 cut(s) 277, 725
HaeIII GGCC 1 cut(s) 214
HapII CCGG 1 cut(s) 116
HhaI GCGC 1 cut(s) 484
Hin1II CATG 2 cut(s) 450, 771
Hin6I GCGC 1 cut(s) 482
HinP1I GCGC 1 cut(s) 482
HindIII AAGCTT 1 cut(s) 534
HinfI GANTC 2 cut(s) 609, 936
HpaII CCGG 1 cut(s) 116
HphI GGTGA 1 cut(s) 532
Hpy166II GTNNAC 1 cut(s) 438
Hpy188I TCNGA 3 cut(s) 170, 223, 569
Hpy188III TCNNGA 6 cut(s) 231, 298, 511, 540, 613, 927
Hpy8I GTNNAC 1 cut(s) 438
HpyAV CCTTC 3 cut(s) 470, 564, 596
HpyCH4V TGCA 7 cut(s) 4, 150, 187, 251, 418, 502, 674
HpyF10VI GCNNNNNNNGC 6 cut(s) 184, 211, 262, 277, 361, 907
HpyF3I CTNAG 9 cut(s) 124, 167, 190, 209, 216, 342, 383, 550, 832
Hsp92II CATG 2 cut(s) 450, 771
HspAI GCGC 1 cut(s) 482
Ksp22I TGATCA 1 cut(s) 288
Kzo9I GATC 3 cut(s) 223, 288, 923
Lsp1109I GCAGC 9 cut(s) 162, 165, 268, 289, 351, 364, 399, 686, 910
LweI GCATC 3 cut(s) 186, 258, 405
MaeI CTAG 2 cut(s) 89, 560
MalI GATC 3 cut(s) 225, 290, 925
MboI GATC 3 cut(s) 223, 288, 923
MluCI AATT 7 cut(s) 27, 292, 301, 457, 694, 739, 843
MnlI CCTC 6 cut(s) 33, 190, 204, 511, 567, 914
MroXI GAANNNNTTC 1 cut(s) 434
MseI TTAA 3 cut(s) 424, 679, 842
MspA1I CMGCKG 3 cut(s) 364, 549, 655
MspI CCGG 1 cut(s) 116
MspR9I CCNGG 1 cut(s) 116
MwoI GCNNNNNNNGC 6 cut(s) 184, 211, 262, 277, 361, 907
NciI CCSGG 1 cut(s) 116
NdeII GATC 3 cut(s) 223, 288, 923
NlaIII CATG 2 cut(s) 450, 771
NspV TTCGAA 1 cut(s) 664
PceI AGGCCT 1 cut(s) 214
PdmI GAANNNNTTC 1 cut(s) 434
PfeI GAWTC 2 cut(s) 609, 936
PflMI CCANNNNNTGG 1 cut(s) 327
PkrI GCNGC 9 cut(s) 152, 155, 258, 279, 354, 366, 389, 676, 900
PshBI ATTAAT 1 cut(s) 842
PspFI CCCAGC 2 cut(s) 273, 721
PstNI CAGNNNCTG 1 cut(s) 721
PvuII CAGCTG 3 cut(s) 364, 549, 655
RsaI GTAC 3 cut(s) 490, 815, 887
RsaNI GTAC 3 cut(s) 489, 814, 886
SaqAI TTAA 3 cut(s) 424, 679, 842
SatI GCNGC 9 cut(s) 151, 154, 257, 278, 353, 365, 388, 675, 899
Sau3AI GATC 3 cut(s) 223, 288, 923
ScrFI CCNGG 1 cut(s) 116
SfaNI GCATC 3 cut(s) 186, 258, 405
SfuI TTCGAA 1 cut(s) 664
SmlI CTYRAG 1 cut(s) 229
SmoI CTYRAG 1 cut(s) 229
SpeI ACTAGT 1 cut(s) 88
Sse9I AATT 7 cut(s) 27, 292, 301, 457, 694, 739, 843
SseBI AGGCCT 1 cut(s) 214
SsiI CCGC 1 cut(s) 331
SspMI CTAG 2 cut(s) 89, 560
StuI AGGCCT 1 cut(s) 214
StyD4I CCNGG 1 cut(s) 114
StyI CCWWGG 2 cut(s) 597, 893
TaqI TCGA 6 cut(s) 64, 299, 454, 469, 539, 664
TasI AATT 7 cut(s) 27, 292, 301, 457, 694, 739, 843
TatI WGTACW 2 cut(s) 488, 885
TfiI GAWTC 2 cut(s) 609, 936
Tru1I TTAA 3 cut(s) 424, 679, 842
Tru9I TTAA 3 cut(s) 424, 679, 842
TscAI CASTG 3 cut(s) 194, 332, 425
TseI GCWGC 9 cut(s) 150, 153, 256, 277, 352, 364, 387, 674, 898
TspDTI ATGAA 3 cut(s) 121, 463, 784
TspGWI ACGGA 1 cut(s) 808
TspRI CASTG 3 cut(s) 194, 332, 425
Van91I CCANNNNNTGG 1 cut(s) 327
VspI ATTAAT 1 cut(s) 842
XapI RAATTY 2 cut(s) 301, 739
XmnI GAANNNNTTC 1 cut(s) 434
XspI CTAG 2 cut(s) 89, 560
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.