Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0027667.1

Orthogroup ID

OG0005085

Physical Location & Seq

Genomic Coordinates Reverse (-)

466 .. 1488

Gene Structure 1023 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0027667.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 492 bp

atgcttttcctagctgtgatcggtctttttctgtccgtccttcggcaccaacatgcaattcacatattcattgttagtggatggctacttgttgcaattacattcattctttgtggagcctttgtgatcctcaacaatgctgtttctgacacctgtatggcaatggaagaatgggtagaaaatccccacgctgaaacagcacttagcaatgtccttccatgtgttgaccagaaaaccacaaaccagacactgagccagagtaaaggaattatcaatgacatggtcactgttgtcaacacgttcatctacacctatgccaatacgtatccatcacattctgatctgtattattacaatcagtctggacctctgatgccagctctttgttacccatatgattctgagttaagagatactcagtgtggggatcaacaggtgtctattacaaatgcttctttggtaagaatcttccacttagactactttggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

163

Amino Acids

18.29

Weight (kDa)

4.88

Isoelectric Point (pI)

35.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005085)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G71110
fragaria_vesca	FvH4_4g32140 FvH4_4g32140 FvH4_4g32140 FvH4_4g32140 FvH4_4g32140
malus_domestica	MD13G1028100.v1.1 MD16G1031000.v1.1
prunus_persica	Prupe.1G322100_v2.0.a1 Prupe.1G322100_v2.0.a1
pyrus_communis	pycom13g02650 pycom16g02700
rosa_chinensis	RchiOBHm_Chr4g0440851
rosa_laevigata	RLG00000006143
rosa_multiflora	Rmu_sc0000424.1_g000016 Rmu_sc0005054.1_g000011 Rmu_sc0012089.1_g000001 Rmu_sc0027667.1_g000001
rosa_roxburghii	Rroxscaffold_5G00381680
rosa_rugosa	Rorug04G0329000 Rorug04G0329100.1
rosa_samantha	Rh4AG380700 Rh4BG393700 Rh4CG408600 Rh4DG387100 Rh5AG282100 Rh5CG319000 Rh5DG296600
rosa_wichuraiana	Rw0G001420 Rw4G032780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	45
AclWI	GGATC	2 cut(s)	121, 435
AfiI	CCNNNNNNNGG	1 cut(s)	42
AflIII	ACRYGT	1 cut(s)	297
AjuI	GAANNNNNNNTTGG	2 cut(s)	42, 74
AluBI	AGCT	2 cut(s)	14, 380
AluI	AGCT	2 cut(s)	14, 380
AlwI	GGATC	2 cut(s)	121, 435
AlwNI	CAGNNNCTG	1 cut(s)	250
AspS9I	GGNCC	1 cut(s)	365
AvaII	GGWCC	1 cut(s)	365
BanI	GGYRCC	1 cut(s)	45
BccI	CCATC	2 cut(s)	75, 337
BciVI	GTATCC	1 cut(s)	336
BfaI	CTAG	1 cut(s)	11
BfuI	GTATCC	1 cut(s)	336
Bme18I	GGWCC	1 cut(s)	365
BmgT120I	GGNCC	1 cut(s)	365
BmiI	GGNNCC	2 cut(s)	47, 118
BmsI	GCATC	1 cut(s)	363
BsaAI	YACGTR	1 cut(s)	324
BsaXI	ACNNNNNCTCC	2 cut(s)	108, 138
Bsc4I	CCNNNNNNNGG	1 cut(s)	42
Bse3DI	GCAATG	2 cut(s)	168, 214
BseGI	GGATG	1 cut(s)	86
BseLI	CCNNNNNNNGG	1 cut(s)	42
BseMI	GCAATG	2 cut(s)	168, 214
BseMII	CTCAG	3 cut(s)	242, 393, 431
BshNI	GGYRCC	1 cut(s)	45
BslI	CCNNNNNNNGG	1 cut(s)	42
Bsp143I	GATC	4 cut(s)	18, 126, 340, 427
BspCNI	CTCAG	3 cut(s)	243, 394, 430
BspLI	GGNNCC	2 cut(s)	47, 118
BspPI	GGATC	2 cut(s)	121, 435
BspT107I	GGYRCC	1 cut(s)	45
BsrDI	GCAATG	2 cut(s)	168, 214
BssMI	GATC	4 cut(s)	18, 126, 340, 427
Bst4CI	ACNGT	1 cut(s)	289
BstBAI	YACGTR	1 cut(s)	324
BstC8I	GCNNGC	1 cut(s)	378
BstDEI	CTNAG	5 cut(s)	203, 251, 402, 417, 475
BstF5I	GGATG	1 cut(s)	86
BstKTI	GATC	4 cut(s)	21, 129, 343, 430
BstMBI	GATC	4 cut(s)	18, 126, 340, 427
BstMWI	GCNNNNNNNGC	1 cut(s)	197
BstNSI	RCATGY	1 cut(s)	56
BstSNI	TACGTA	1 cut(s)	324
BsuI	GTATCC	1 cut(s)	336
BtsCI	GGATG	1 cut(s)	86
BtsIMutI	CAGTG	3 cut(s)	248, 285, 425
Cac8I	GCNNGC	1 cut(s)	378
CaiI	CAGNNNCTG	1 cut(s)	250
Cfr13I	GGNCC	1 cut(s)	365
CviAII	CATG	3 cut(s)	53, 219, 280
CviJI	RGCY	5 cut(s)	14, 85, 119, 255, 380
CviKI_1	RGCY	5 cut(s)	14, 85, 119, 255, 380
DdeI	CTNAG	5 cut(s)	203, 251, 402, 417, 475
DpnI	GATC	4 cut(s)	20, 128, 342, 429
DpnII	GATC	4 cut(s)	18, 126, 340, 427
Eco105I	TACGTA	1 cut(s)	324
Eco47I	GGWCC	1 cut(s)	365
FaeI	CATG	3 cut(s)	56, 222, 283
FaiI	YATR	8 cut(s)	54, 65, 158, 220, 281, 315, 394, 396
FatI	CATG	3 cut(s)	52, 218, 279
FauNDI	CATATG	1 cut(s)	394
FokI	GGATG	1 cut(s)	93
FspBI	CTAG	1 cut(s)	11
Hin1II	CATG	3 cut(s)	56, 222, 283
HincII	GTYRAC	2 cut(s)	226, 295
HindII	GTYRAC	2 cut(s)	226, 295
HinfI	GANTC	2 cut(s)	398, 465
Hpy166II	GTNNAC	2 cut(s)	226, 295
Hpy188I	TCNGA	4 cut(s)	148, 340, 372, 403
Hpy188III	TCNNGA	1 cut(s)	363
Hpy8I	GTNNAC	2 cut(s)	226, 295
HpyAV	CCTTC	2 cut(s)	50, 224
HpyCH4III	ACNGT	1 cut(s)	289
HpyCH4IV	ACGT	2 cut(s)	299, 323
HpyCH4V	TGCA	2 cut(s)	56, 95
HpyF10VI	GCNNNNNNNGC	1 cut(s)	197
HpyF3I	CTNAG	5 cut(s)	203, 251, 402, 417, 475
HpySE526I	ACGT	2 cut(s)	299, 323
Hsp92II	CATG	3 cut(s)	56, 222, 283
Kzo9I	GATC	4 cut(s)	18, 126, 340, 427
LmnI	GCTCC	1 cut(s)	116
LpnPI	CCDG	7 cut(s)	166, 242, 257, 269, 348, 390, 419
LweI	GCATC	1 cut(s)	363
MaeI	CTAG	1 cut(s)	11
MaeII	ACGT	2 cut(s)	299, 323
MaeIII	GTNAC	2 cut(s)	283, 386
MalI	GATC	4 cut(s)	20, 128, 342, 429
MboI	GATC	4 cut(s)	18, 126, 340, 427
MboII	GAAGA	2 cut(s)	179, 460
MluCI	AATT	3 cut(s)	57, 96, 267
MnlI	CCTC	2 cut(s)	140, 378
MseI	TTAA	1 cut(s)	407
MslI	CAYNNNNRTG	2 cut(s)	51, 155
MwoI	GCNNNNNNNGC	1 cut(s)	197
NdeI	CATATG	1 cut(s)	394
NdeII	GATC	4 cut(s)	18, 126, 340, 427
NlaIII	CATG	3 cut(s)	56, 222, 283
NlaIV	GGNNCC	2 cut(s)	47, 118
NmuCI	GTSAC	1 cut(s)	283
NspI	RCATGY	1 cut(s)	56
PfeI	GAWTC	2 cut(s)	398, 465
PflFI	GACNNNGTC	1 cut(s)	281
Ppu21I	YACGTR	1 cut(s)	324
PspN4I	GGNNCC	2 cut(s)	47, 118
PspPI	GGNCC	1 cut(s)	365
PstNI	CAGNNNCTG	1 cut(s)	250
PsyI	GACNNNGTC	1 cut(s)	281
RseI	CAYNNNNRTG	2 cut(s)	51, 155
SaqAI	TTAA	1 cut(s)	407
Sau3AI	GATC	4 cut(s)	18, 126, 340, 427
Sau96I	GGNCC	1 cut(s)	365
SetI	ASST	8 cut(s)	16, 155, 302, 314, 326, 370, 382, 438
SfaNI	GCATC	1 cut(s)	363
SinI	GGWCC	1 cut(s)	365
SmiMI	CAYNNNNRTG	2 cut(s)	51, 155
SnaBI	TACGTA	1 cut(s)	324
Sse9I	AATT	3 cut(s)	57, 96, 267
SspMI	CTAG	1 cut(s)	11
TaaI	ACNGT	1 cut(s)	289
TaiI	ACGT	2 cut(s)	302, 326
TaqII	GACCGA	1 cut(s)	11
TasI	AATT	3 cut(s)	57, 96, 267
TfiI	GAWTC	2 cut(s)	398, 465
Tru1I	TTAA	1 cut(s)	407
Tru9I	TTAA	1 cut(s)	407
TscAI	CASTG	3 cut(s)	255, 292, 425
TseFI	GTSAC	1 cut(s)	283
Tsp45I	GTSAC	1 cut(s)	283
TspDTI	ATGAA	3 cut(s)	58, 94, 292
TspGWI	ACGGA	1 cut(s)	25
TspRI	CASTG	3 cut(s)	255, 292, 425
Tth111I	GACNNNGTC	1 cut(s)	281
VpaK11BI	GGWCC	1 cut(s)	365
XceI	RCATGY	1 cut(s)	56
XspI	CTAG	1 cut(s)	11

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.