Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5D

Orthogroup ID

OG0005085

Physical Location & Seq

Genomic Coordinates Forward (+)

37423448 .. 37425170

Gene Structure 1723 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5DG296600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 585 bp

ATGCTTTTCCTAGCTGTGATCGGTCTTTTTCTGTCCGTCCTTCGGCACCAACATGCAATTCACATATTCATTGTTAGTGGATGGCTACTTGTTGCAATTACATTCATTCTTTGTGGAGCCTTTGTGATCCTCAACAATGCTGTTTCTGACACCTGTATGGCAATGGAAGAATGGGTAGAAAATCCCCACGCTGAAACAGCACTTAGCAATGTCCTTCCATGTGTTGACCAAAAAACCACAAACCACACACTGAGCCAGAGTAAAGGAATTATCAATGACATGGTCACTGTTGTCAACACGTTCATCTACACCTATGCCAATACGTATCCATCGCATTCTGATCTGTATTATTACAATCAGTCTGGACCTCTGATGCCAGCTCTTTGTTACCCATATGATTCTGAGTTAAGAGATACTCAGTGTGGGGATCAACAGGTGTCTATTACAAATGCTTCTTTGGTTTGGCAGAACTATACATGTGAAGTCTCAGCATCTGGGATGTGCATCACTCCCGGAAGGGTGAAGCCAGAGATCTACACTCAGCTAGTTGCAGTAGTTAATGAGAGCTATGCACTACAGCACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

194

Amino Acids

21.62

Weight (kDa)

4.97

Isoelectric Point (pI)

35.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005085)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G71110
fragaria_vesca	FvH4_4g32140 FvH4_4g32140 FvH4_4g32140 FvH4_4g32140 FvH4_4g32140
malus_domestica	MD13G1028100.v1.1 MD16G1031000.v1.1
prunus_persica	Prupe.1G322100_v2.0.a1 Prupe.1G322100_v2.0.a1
pyrus_communis	pycom13g02650 pycom16g02700
rosa_chinensis	RchiOBHm_Chr4g0440851
rosa_laevigata	RLG00000006143
rosa_multiflora	Rmu_sc0000424.1_g000016 Rmu_sc0005054.1_g000011 Rmu_sc0012089.1_g000001 Rmu_sc0027667.1_g000001
rosa_roxburghii	Rroxscaffold_5G00381680
rosa_rugosa	Rorug04G0329000 Rorug04G0329100.1
rosa_samantha	Rh4AG380700 Rh4BG393700 Rh4CG408600 Rh4DG387100 Rh5AG282100 Rh5CG319000 Rh5DG296600
rosa_wichuraiana	Rw0G001420 Rw4G032780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	45
AclWI	GGATC	2 cut(s)	121, 435
AfiI	CCNNNNNNNGG	1 cut(s)	42
AflIII	ACRYGT	2 cut(s)	297, 476
AjuI	GAANNNNNNNTTGG	2 cut(s)	42, 74
AluBI	AGCT	4 cut(s)	14, 380, 544, 567
AluI	AGCT	4 cut(s)	14, 380, 544, 567
Alw26I	GTCTC	1 cut(s)	490
AlwI	GGATC	2 cut(s)	121, 435
AlwNI	CAGNNNCTG	1 cut(s)	494
AspS9I	GGNCC	1 cut(s)	365
AsuC2I	CCSGG	1 cut(s)	513
AsuHPI	GGTGA	1 cut(s)	532
AvaII	GGWCC	1 cut(s)	365
BanI	GGYRCC	1 cut(s)	45
BccI	CCATC	2 cut(s)	75, 337
BciVI	GTATCC	1 cut(s)	336
BcnI	CCSGG	1 cut(s)	513
BcoDI	GTCTC	1 cut(s)	490
BfaI	CTAG	2 cut(s)	11, 545
BfmI	CTRYAG	1 cut(s)	575
BfuI	GTATCC	1 cut(s)	336
BglII	AGATCT	1 cut(s)	531
Bme1390I	CCNGG	1 cut(s)	513
Bme18I	GGWCC	1 cut(s)	365
BmgT120I	GGNCC	1 cut(s)	365
BmiI	GGNNCC	2 cut(s)	47, 118
BmrFI	CCNGG	1 cut(s)	513
BmsI	GCATC	3 cut(s)	363, 500, 513
BpuMI	CCSGG	1 cut(s)	513
BsaAI	YACGTR	1 cut(s)	324
BsaBI	GATNNNNATC	1 cut(s)	503
BsaXI	ACNNNNNCTCC	2 cut(s)	108, 138
Bsc4I	CCNNNNNNNGG	1 cut(s)	42
Bse3DI	GCAATG	2 cut(s)	168, 214
Bse8I	GATNNNNATC	1 cut(s)	503
BseGI	GGATG	2 cut(s)	86, 504
BseJI	GATNNNNATC	1 cut(s)	503
BseLI	CCNNNNNNNGG	1 cut(s)	42
BseMI	GCAATG	2 cut(s)	168, 214
BseMII	CTCAG	5 cut(s)	242, 393, 431, 501, 554
BshNI	GGYRCC	1 cut(s)	45
BsiSI	CCGG	1 cut(s)	513
BslI	CCNNNNNNNGG	1 cut(s)	42
BsmAI	GTCTC	1 cut(s)	490
BsmI	GAATGC	1 cut(s)	334
Bsp143I	GATC	5 cut(s)	18, 126, 340, 427, 531
BspCNI	CTCAG	5 cut(s)	243, 394, 430, 500, 553
BspLI	GGNNCC	2 cut(s)	47, 118
BspPI	GGATC	2 cut(s)	121, 435
BspT107I	GGYRCC	1 cut(s)	45
BsrDI	GCAATG	2 cut(s)	168, 214
BssMI	GATC	5 cut(s)	18, 126, 340, 427, 531
Bst4CI	ACNGT	1 cut(s)	289
BstBAI	YACGTR	1 cut(s)	324
BstC8I	GCNNGC	1 cut(s)	378
BstDEI	CTNAG	6 cut(s)	203, 251, 402, 417, 487, 540
BstF5I	GGATG	2 cut(s)	86, 504
BstKTI	GATC	5 cut(s)	21, 129, 343, 430, 534
BstMAI	GTCTC	1 cut(s)	490
BstMBI	GATC	5 cut(s)	18, 126, 340, 427, 531
BstMWI	GCNNNNNNNGC	1 cut(s)	197
BstNSI	RCATGY	2 cut(s)	56, 480
BstSCI	CCNGG	1 cut(s)	511
BstSFI	CTRYAG	1 cut(s)	575
BstSNI	TACGTA	1 cut(s)	324
BstX2I	RGATCY	1 cut(s)	531
BstYI	RGATCY	1 cut(s)	531
BsuI	GTATCC	1 cut(s)	336
BtgZI	GCGATG	1 cut(s)	315
BtsCI	GGATG	2 cut(s)	86, 504
BtsIMutI	CAGTG	3 cut(s)	248, 285, 425
Cac8I	GCNNGC	1 cut(s)	378
CaiI	CAGNNNCTG	1 cut(s)	494
Cfr13I	GGNCC	1 cut(s)	365
CviAII	CATG	4 cut(s)	53, 219, 280, 477
CviJI	RGCY	8 cut(s)	14, 85, 119, 255, 380, 526, 544, 567
CviKI_1	RGCY	8 cut(s)	14, 85, 119, 255, 380, 526, 544, 567
DdeI	CTNAG	6 cut(s)	203, 251, 402, 417, 487, 540
DpnI	GATC	5 cut(s)	20, 128, 342, 429, 533
DpnII	GATC	5 cut(s)	18, 126, 340, 427, 531
Eco105I	TACGTA	1 cut(s)	324
Eco47I	GGWCC	1 cut(s)	365
FaeI	CATG	4 cut(s)	56, 222, 283, 480
FatI	CATG	4 cut(s)	52, 218, 279, 476
FauNDI	CATATG	1 cut(s)	394
FokI	GGATG	2 cut(s)	93, 511
FspBI	CTAG	2 cut(s)	11, 545
HapII	CCGG	1 cut(s)	513
Hin1II	CATG	4 cut(s)	56, 222, 283, 480
HincII	GTYRAC	2 cut(s)	226, 295
HindII	GTYRAC	2 cut(s)	226, 295
HinfI	GANTC	1 cut(s)	398
HpaII	CCGG	1 cut(s)	513
HphI	GGTGA	1 cut(s)	532
Hpy166II	GTNNAC	2 cut(s)	226, 295
Hpy188I	TCNGA	4 cut(s)	148, 340, 372, 403
Hpy188III	TCNNGA	1 cut(s)	363
Hpy8I	GTNNAC	2 cut(s)	226, 295
HpyAV	CCTTC	3 cut(s)	50, 224, 510
HpyCH4III	ACNGT	1 cut(s)	289
HpyCH4IV	ACGT	2 cut(s)	299, 323
HpyCH4V	TGCA	5 cut(s)	56, 95, 504, 551, 572
HpyF10VI	GCNNNNNNNGC	1 cut(s)	197
HpyF3I	CTNAG	6 cut(s)	203, 251, 402, 417, 487, 540
HpySE526I	ACGT	2 cut(s)	299, 323
Hsp92II	CATG	4 cut(s)	56, 222, 283, 480
Kzo9I	GATC	5 cut(s)	18, 126, 340, 427, 531
LmnI	GCTCC	1 cut(s)	116
LpnPI	CCDG	8 cut(s)	166, 269, 348, 390, 419, 480, 526, 540
LweI	GCATC	3 cut(s)	363, 500, 513
MaeI	CTAG	2 cut(s)	11, 545
MaeII	ACGT	2 cut(s)	299, 323
MaeIII	GTNAC	2 cut(s)	283, 386
MalI	GATC	5 cut(s)	20, 128, 342, 429, 533
MboI	GATC	5 cut(s)	18, 126, 340, 427, 531
MboII	GAAGA	1 cut(s)	179
MflI	RGATCY	1 cut(s)	531
MluCI	AATT	3 cut(s)	57, 96, 267
MnlI	CCTC	2 cut(s)	140, 378
MseI	TTAA	2 cut(s)	407, 558
MslI	CAYNNNNRTG	2 cut(s)	51, 155
MspI	CCGG	1 cut(s)	513
MspR9I	CCNGG	1 cut(s)	513
Mva1269I	GAATGC	1 cut(s)	334
MwoI	GCNNNNNNNGC	1 cut(s)	197
NciI	CCSGG	1 cut(s)	513
NdeI	CATATG	1 cut(s)	394
NdeII	GATC	5 cut(s)	18, 126, 340, 427, 531
NlaIII	CATG	4 cut(s)	56, 222, 283, 480
NlaIV	GGNNCC	2 cut(s)	47, 118
NmuCI	GTSAC	1 cut(s)	283
NspI	RCATGY	2 cut(s)	56, 480
PciI	ACATGT	1 cut(s)	476
PctI	GAATGC	1 cut(s)	334
PfeI	GAWTC	1 cut(s)	398
PflFI	GACNNNGTC	1 cut(s)	281
PfoI	TCCNGGA	1 cut(s)	511
Ppu21I	YACGTR	1 cut(s)	324
PscI	ACATGT	1 cut(s)	476
PspN4I	GGNNCC	2 cut(s)	47, 118
PspPI	GGNCC	1 cut(s)	365
PstNI	CAGNNNCTG	1 cut(s)	494
PsuI	RGATCY	1 cut(s)	531
PsyI	GACNNNGTC	1 cut(s)	281
RseI	CAYNNNNRTG	2 cut(s)	51, 155
SaqAI	TTAA	2 cut(s)	407, 558
Sau3AI	GATC	5 cut(s)	18, 126, 340, 427, 531
Sau96I	GGNCC	1 cut(s)	365
ScrFI	CCNGG	1 cut(s)	513
SfaNI	GCATC	3 cut(s)	363, 500, 513
SfcI	CTRYAG	1 cut(s)	575
SinI	GGWCC	1 cut(s)	365
SmiMI	CAYNNNNRTG	2 cut(s)	51, 155
SnaBI	TACGTA	1 cut(s)	324
Sse9I	AATT	3 cut(s)	57, 96, 267
SspMI	CTAG	2 cut(s)	11, 545
StyD4I	CCNGG	1 cut(s)	511
TaaI	ACNGT	1 cut(s)	289
TaiI	ACGT	2 cut(s)	302, 326
TaqII	GACCGA	1 cut(s)	11
TasI	AATT	3 cut(s)	57, 96, 267
TfiI	GAWTC	1 cut(s)	398
Tru1I	TTAA	2 cut(s)	407, 558
Tru9I	TTAA	2 cut(s)	407, 558
TscAI	CASTG	3 cut(s)	255, 292, 425
TseFI	GTSAC	1 cut(s)	283
Tsp45I	GTSAC	1 cut(s)	283
TspDTI	ATGAA	3 cut(s)	58, 94, 292
TspGWI	ACGGA	1 cut(s)	25
TspRI	CASTG	3 cut(s)	255, 292, 425
Tth111I	GACNNNGTC	1 cut(s)	281
VpaK11BI	GGWCC	1 cut(s)	365
XceI	RCATGY	2 cut(s)	56, 480
XspI	CTAG	2 cut(s)	11, 545

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.