Rmu_sc0029085.1_g000001

monooxygenase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029085.1
Physical Location & Seq
Forward (+)
63 .. 401
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029085.1_g000001.1.cds

Sequence Viewer

Length: 339 bp
atgcttcttactttaggtccagtattctcacacagaaacactgagtgcctagcctcagtatggcaaaaacgcacctatgacaggctcaagcttcatcttcccaaggcattttgccaactccctaaacttccattccctgaggacttccctgagtatccaacaaagagacaattcatcgactaccttgaatcatacgccaaacactttgaaatcaacccaaaattcaactcctccgtccaatcagcccgctacgacgagaccagcggtttctggagggtcaagacagtttcaacaaccgggtcaacccgaatgcaggtggctcatagttaccaccagtga

Protein Analysis

112

Amino Acids

13.2

Weight (kDa)

9.36

Isoelectric Point (pI)

49.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 304
Acc36I ACCTGC 1 cut(s) 304
AciI CCGC 2 cut(s) 247, 264
AcsI RAATTY 1 cut(s) 221
AdeI CACNNNGTG 1 cut(s) 45
AfiI CCNNNNNNNGG 3 cut(s) 60, 81, 313
AgsI TTSAA 4 cut(s) 188, 209, 226, 291
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
Alw26I GTCTC 2 cut(s) 160, 251
ApoI RAATTY 1 cut(s) 221
AspS9I GGNCC 1 cut(s) 17
AsuC2I CCSGG 1 cut(s) 298
AvaII GGWCC 1 cut(s) 17
AxyI CCTNAGG 1 cut(s) 138
BciVI GTATCC 1 cut(s) 165
BcnI CCSGG 1 cut(s) 298
BcoDI GTCTC 2 cut(s) 160, 251
BfaI CTAG 1 cut(s) 50
BfuAI ACCTGC 1 cut(s) 304
BfuI GTATCC 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 298
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 298
BpmI CTGGAG 1 cut(s) 292
BpuEI CTTGAG 1 cut(s) 71
BpuMI CCSGG 1 cut(s) 298
BsaI GGTCTC 1 cut(s) 251
BsaJI CCNNGG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 3 cut(s) 60, 81, 313
Bse1I ACTGG 2 cut(s) 20, 334
Bse21I CCTNAGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 102
BseLI CCNNNNNNNGG 3 cut(s) 60, 81, 313
BseMII CTCAG 4 cut(s) 33, 69, 129, 141
BseNI ACTGG 2 cut(s) 20, 334
BseRI GAGGAG 1 cut(s) 220
BsiSI CCGG 1 cut(s) 297
BslI CCNNNNNNNGG 3 cut(s) 60, 81, 313
BsmAI GTCTC 2 cut(s) 160, 251
BsmI GAATGC 1 cut(s) 315
Bso31I GGTCTC 1 cut(s) 251
BspACI CCGC 2 cut(s) 247, 264
BspCNI CTCAG 4 cut(s) 34, 68, 130, 142
BspMI ACCTGC 1 cut(s) 304
BspTNI GGTCTC 1 cut(s) 251
BsrI ACTGG 2 cut(s) 20, 334
BssECI CCNNGG 1 cut(s) 102
BssT1I CCWWGG 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 286
BstC8I GCNNGC 1 cut(s) 247
BstDEI CTNAG 4 cut(s) 42, 55, 138, 150
BstENI CCTNNNNNAGG 1 cut(s) 79
BstMAI GTCTC 2 cut(s) 160, 251
BstSCI CCNGG 1 cut(s) 296
Bsu36I CCTNAGG 1 cut(s) 138
BsuI GTATCC 1 cut(s) 165
BtsIMutI CAGTG 1 cut(s) 39
BveI ACCTGC 1 cut(s) 304
Cac8I GCNNGC 1 cut(s) 247
Cfr13I GGNCC 1 cut(s) 17
CviJI RGCY 5 cut(s) 53, 85, 91, 245, 320
CviKI_1 RGCY 5 cut(s) 53, 85, 91, 245, 320
DdeI CTNAG 4 cut(s) 42, 55, 138, 150
DraIII CACNNNGTG 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 102
Eco31I GGTCTC 1 cut(s) 251
Eco47I GGWCC 1 cut(s) 17
Eco81I CCTNAGG 1 cut(s) 138
EcoNI CCTNNNNNAGG 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaiI YATR 4 cut(s) 61, 78, 193, 324
FauI CCCGC 1 cut(s) 254
FspBI CTAG 1 cut(s) 50
GsuI CTGGAG 1 cut(s) 292
HapII CCGG 1 cut(s) 297
HincII GTYRAC 1 cut(s) 303
HindII GTYRAC 1 cut(s) 303
HindIII AAGCTT 1 cut(s) 89
HinfI GANTC 1 cut(s) 188
HpaII CCGG 1 cut(s) 297
Hpy166II GTNNAC 1 cut(s) 303
Hpy188III TCNNGA 2 cut(s) 271, 280
Hpy8I GTNNAC 1 cut(s) 303
Hpy99I CGWCG 1 cut(s) 257
HpyCH4III ACNGT 1 cut(s) 286
HpyCH4V TGCA 1 cut(s) 313
HpyF3I CTNAG 4 cut(s) 42, 55, 138, 150
LpnPI CCDG 8 cut(s) 33, 67, 150, 162, 256, 274, 299, 310
MaeI CTAG 1 cut(s) 50
MaeIII GTNAC 1 cut(s) 326
MboII GAAGA 1 cut(s) 89
MluCI AATT 2 cut(s) 170, 221
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 4 cut(s) 64, 133, 241, 267
MspA1I CMGCKG 1 cut(s) 264
MspI CCGG 1 cut(s) 297
MspR9I CCNGG 1 cut(s) 298
Mva1269I GAATGC 1 cut(s) 315
NciI CCSGG 1 cut(s) 298
PaqCI CACCTGC 1 cut(s) 304
PctI GAATGC 1 cut(s) 315
PfeI GAWTC 1 cut(s) 188
PspPI GGNCC 1 cut(s) 17
Sau96I GGNCC 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 298
SetI ASST 5 cut(s) 19, 77, 93, 186, 318
SinI GGWCC 1 cut(s) 17
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 2 cut(s) 170, 221
SsiI CCGC 2 cut(s) 247, 264
SspMI CTAG 1 cut(s) 50
StyD4I CCNGG 1 cut(s) 296
StyI CCWWGG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 286
TaqI TCGA 1 cut(s) 177
TasI AATT 2 cut(s) 170, 221
TfiI GAWTC 1 cut(s) 188
TscAI CASTG 1 cut(s) 46
TspDTI ATGAA 2 cut(s) 83, 163
TspGWI ACGGA 1 cut(s) 223
TspRI CASTG 1 cut(s) 46
VpaK11BI GGWCC 1 cut(s) 17
XagI CCTNNNNNAGG 1 cut(s) 79
XapI RAATTY 1 cut(s) 221
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.