Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0030462.1

Orthogroup ID

OG0005585

Physical Location & Seq

Genomic Coordinates Reverse (-)

97 .. 1152

Gene Structure 1056 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0030462.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1056 bp

atgactgtcaccctgaatgcttacaatgttgttgtgtgtcgatgtgcggctgagtatatgggaatgcacgagtctattgagaaaggaaatctcatatacaagattgatgtgtttcttaactctagcattttccgcagctggaaggattcaatcattgttcttcagactacaaagtctcttttgccgatatccgaggacctgaagttggtcagccagtgcattgattcgatagctaccaaggcctgtgtcgatgtttcaaaagttgactggtcctatacctataaccggaagaaacttgcagaggaaaatgggaacgatccaaattggaatggtgtcagaaaccgtcaagttccaaaggattggtgggtggaggaattatgtgagcttgagattgatttgtttaagcgtgttcttatgagtattaaaaccaaagcagtactttctggtgaagtgatcggagaagccttgaaagcttatacttacagaaggttgccaggtttcagcaaaggtatgatccagagtggagatatgggaaagcatcgatcaacagtggatgcaattgtctggctgttgcctgcagagaaaggcagcatctcttgtagtttcttgctcaaattgttaaaagcagctatatatgtgaactctggagaaacgaccaaggatgagatggtaaagagaataggacagcaactggaggaggcttcagtaaatgatcttttgatacgagcagcagaaggagaagctactatatatgatgttagtgcagttaaaaaaatagtagaagagtttctaaagaaagatcagactgcagagattcaatcattagaagagggccatgagattcaggaggagaggaggccagggatcttgtcagatgcttctaagttgatggtggcaaaactgatagatgggtatcttgctgaaatttcaaaggatccgaacctacccttgtccaagtttgtcgatcttgcagaaatggtgtcaggtttctctcgccctgctcatgatgggctttaccgagccattgacatgtttctcaaggtaggagcctcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0008150 GO:0009605 GO:0009606 GO:0009628 GO:0009629 GO:0009630 GO:0009958 GO:0044464 GO:0050896 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BTB NPH3

Protein Analysis

351

Amino Acids

39.3

Weight (kDa)

5.64

Isoelectric Point (pI)

35.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005585)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G14820 AT2G14820
fragaria_vesca	FvH4_2g04110 FvH4_2g04110 FvH4_2g04110 FvH4_2g04110
malus_domestica	MD05G1098200.v1.1 MD10G1103900.v1.1
prunus_persica	Prupe.8G142300_v2.0.a1 Prupe.8G142300_v2.0.a1 Prupe.8G142300_v2.0.a1
pyrus_communis	pycom05g09610 pycom10g08930
rosa_chinensis	RchiOBHm_Chr6g0253481
rosa_laevigata	RLG00000015016
rosa_multiflora	Rmu_sc0030462.1_g000001 Rmu_ssc0000079.1_g000008
rosa_roxburghii	Rroxscaffold_7G00211860
rosa_rugosa	Rorug05G0544500 Rorug05G0544600 Rorug05G0544700 Rorug05G0544700
rosa_samantha	Rh3CG324600 Rh3DG323200 Rh6AG059600 Rh6BG053600 Rh6CG050700 Rh6DG047400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	172
AciI	CCGC	2 cut(s)	47, 133
AclWI	GGATC	5 cut(s)	311, 508, 872, 929, 942
AcsI	RAATTY	1 cut(s)	924
AcuI	CTGAAG	3 cut(s)	146, 221, 687
AfaI	GTAC	1 cut(s)	438
AfiI	CCNNNNNNNGG	2 cut(s)	205, 285
AflIII	ACRYGT	1 cut(s)	1029
AgsI	TTSAA	5 cut(s)	150, 258, 469, 818, 930
AjnI	CCWGG	2 cut(s)	493, 859
AluBI	AGCT	6 cut(s)	138, 233, 385, 473, 629, 743
AluI	AGCT	6 cut(s)	138, 233, 385, 473, 629, 743
Alw26I	GTCTC	1 cut(s)	180
AlwI	GGATC	5 cut(s)	311, 508, 872, 929, 942
AlwNI	CAGNNNCTG	1 cut(s)	691
AoxI	GGCC	3 cut(s)	240, 832, 857
ApeKI	GCWGC	4 cut(s)	135, 588, 626, 728
ApoI	RAATTY	1 cut(s)	924
Asp700I	GAANNNNTTC	1 cut(s)	786
AspS9I	GGNCC	3 cut(s)	196, 270, 832
AsuHPI	GGTGA	1 cut(s)	458
AvaII	GGWCC	2 cut(s)	196, 270
BamHI	GGATCC	1 cut(s)	934
BauI	CACGAG	1 cut(s)	68
BbvI	GCAGC	4 cut(s)	147, 600, 638, 740
BccI	CCATC	4 cut(s)	661, 883, 902, 1001
BciT130I	CCWGG	2 cut(s)	495, 861
BcoDI	GTCTC	1 cut(s)	180
BfaI	CTAG	1 cut(s)	123
BfmI	CTRYAG	2 cut(s)	576, 807
BisI	GCNGC	5 cut(s)	48, 136, 589, 627, 729
BlsI	GCNGC	5 cut(s)	49, 137, 590, 628, 730
BmcAI	AGTACT	1 cut(s)	438
Bme1390I	CCNGG	2 cut(s)	495, 861
Bme18I	GGWCC	2 cut(s)	196, 270
BmgT120I	GGNCC	3 cut(s)	196, 270, 832
BmiI	GGNNCC	2 cut(s)	936, 1048
BmrFI	CCNGG	2 cut(s)	495, 861
BmsI	GCATC	4 cut(s)	544, 547, 600, 865
BpmI	CTGGAG	2 cut(s)	666, 713
BpuEI	CTTGAG	2 cut(s)	407, 1022
Bsa29I	ATCGAT	1 cut(s)	541
BsaBI	GATNNNNATC	1 cut(s)	912
BsaJI	CCNNGG	4 cut(s)	192, 237, 657, 860
BsaWI	WCCGGW	1 cut(s)	285
Bsc4I	CCNNNNNNNGG	2 cut(s)	205, 285
Bse1I	ACTGG	3 cut(s)	214, 272, 696
Bse8I	GATNNNNATC	1 cut(s)	912
BseBI	CCWGG	2 cut(s)	495, 861
BseCI	ATCGAT	1 cut(s)	541
BseDI	CCNNGG	4 cut(s)	192, 237, 657, 860
BseGI	GGATG	2 cut(s)	559, 667
BseJI	GATNNNNATC	1 cut(s)	912
BseLI	CCNNNNNNNGG	2 cut(s)	205, 285
BseMII	CTCAG	1 cut(s)	42
BseNI	ACTGG	3 cut(s)	214, 272, 696
BseRI	GAGGAG	3 cut(s)	710, 863, 868
BseXI	GCAGC	4 cut(s)	147, 600, 638, 740
BsgI	GTGCAG	1 cut(s)	783
BshFI	GGCC	3 cut(s)	242, 834, 859
BshVI	ATCGAT	1 cut(s)	541
BsiSI	CCGG	1 cut(s)	286
BslI	CCNNNNNNNGG	2 cut(s)	205, 285
BsmAI	GTCTC	1 cut(s)	180
BsmI	GAATGC	2 cut(s)	22, 69
BsnI	GGCC	3 cut(s)	242, 834, 859
Bsp143I	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
BspACI	CCGC	2 cut(s)	47, 133
BspANI	GGCC	3 cut(s)	242, 834, 859
BspCNI	CTCAG	1 cut(s)	43
BspDI	ATCGAT	1 cut(s)	541
BspHI	TCATGA	1 cut(s)	1003
BspLI	GGNNCC	2 cut(s)	936, 1048
BspMAI	CTGCAG	2 cut(s)	580, 811
BspPI	GGATC	5 cut(s)	311, 508, 872, 929, 942
BsrI	ACTGG	3 cut(s)	214, 272, 696
BssECI	CCNNGG	4 cut(s)	192, 237, 657, 860
BssMI	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
BssSI	CACGAG	1 cut(s)	68
BssT1I	CCWWGG	2 cut(s)	237, 657
Bst2BI	CACGAG	1 cut(s)	68
Bst2UI	CCWGG	2 cut(s)	495, 861
Bst4CI	ACNGT	3 cut(s)	7, 344, 550
Bst6I	CTCTTC	2 cut(s)	777, 822
BstC8I	GCNNGC	1 cut(s)	576
BstDEI	CTNAG	2 cut(s)	51, 882
BstF5I	GGATG	2 cut(s)	559, 667
BstKTI	GATC	9 cut(s)	319, 456, 516, 545, 715, 802, 867, 937, 967
BstMAI	GTCTC	1 cut(s)	180
BstMBI	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
BstMWI	GCNNNNNNNGC	3 cut(s)	132, 239, 470
BstNI	CCWGG	2 cut(s)	495, 861
BstNSI	RCATGY	1 cut(s)	1033
BstSCI	CCNGG	2 cut(s)	493, 859
BstSFI	CTRYAG	2 cut(s)	576, 807
BstV1I	GCAGC	4 cut(s)	147, 600, 638, 740
BstX2I	RGATCY	2 cut(s)	864, 934
BstXI	CCANNNNNNTGG	1 cut(s)	360
BstYI	RGATCY	2 cut(s)	864, 934
Bsu15I	ATCGAT	1 cut(s)	541
BsuRI	GGCC	3 cut(s)	242, 834, 859
BsuTUI	ATCGAT	1 cut(s)	541
BtsCI	GGATG	2 cut(s)	559, 667
BtsIMutI	CAGTG	2 cut(s)	221, 555
Cac8I	GCNNGC	1 cut(s)	576
CaiI	CAGNNNCTG	1 cut(s)	691
CciI	TCATGA	1 cut(s)	1003
Cfr13I	GGNCC	3 cut(s)	196, 270, 832
ClaI	ATCGAT	1 cut(s)	541
Csp6I	GTAC	1 cut(s)	437
CviAII	CATG	3 cut(s)	836, 1004, 1030
CviQI	GTAC	1 cut(s)	437
DdeI	CTNAG	2 cut(s)	51, 882
DpnI	GATC	9 cut(s)	318, 455, 515, 544, 714, 801, 866, 936, 966
DpnII	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
DrdI	GACNNNNNNGTC	1 cut(s)	172
DseDI	GACNNNNNNGTC	1 cut(s)	172
Eam1104I	CTCTTC	2 cut(s)	777, 822
EarI	CTCTTC	2 cut(s)	777, 822
Eco130I	CCWWGG	2 cut(s)	237, 657
Eco147I	AGGCCT	1 cut(s)	242
Eco32I	GATATC	1 cut(s)	189
Eco47I	GGWCC	2 cut(s)	196, 270
Eco57I	CTGAAG	3 cut(s)	146, 221, 687
EcoO109I	RGGNCCY	1 cut(s)	196
EcoRII	CCWGG	2 cut(s)	493, 859
EcoRV	GATATC	1 cut(s)	189
EcoT14I	CCWWGG	2 cut(s)	237, 657
ErhI	CCWWGG	2 cut(s)	237, 657
FaeI	CATG	3 cut(s)	839, 1007, 1033
FalI	AAGNNNNNCTT	2 cut(s)	423, 455
FatI	CATG	3 cut(s)	835, 1003, 1029
Fnu4HI	GCNGC	5 cut(s)	48, 136, 589, 627, 729
FokI	GGATG	2 cut(s)	566, 674
Fsp4HI	GCNGC	5 cut(s)	48, 136, 589, 627, 729
FspBI	CTAG	1 cut(s)	123
GluI	GCNGC	5 cut(s)	48, 136, 589, 627, 729
GsuI	CTGGAG	2 cut(s)	666, 713
HaeIII	GGCC	3 cut(s)	242, 834, 859
HapII	CCGG	1 cut(s)	286
Hin1II	CATG	3 cut(s)	839, 1007, 1033
HincII	GTYRAC	1 cut(s)	265
HindII	GTYRAC	1 cut(s)	265
HindIII	AAGCTT	1 cut(s)	471
HinfI	GANTC	5 cut(s)	71, 146, 224, 814, 841
HpaII	CCGG	1 cut(s)	286
HphI	GGTGA	1 cut(s)	458
Hpy166II	GTNNAC	2 cut(s)	265, 640
Hpy188I	TCNGA	7 cut(s)	165, 193, 338, 458, 804, 874, 939
Hpy188III	TCNNGA	5 cut(s)	517, 645, 845, 1004, 1053
Hpy8I	GTNNAC	2 cut(s)	265, 640
HpyAV	CCTTC	3 cut(s)	136, 480, 728
HpyCH4III	ACNGT	3 cut(s)	7, 344, 550
HpyCH4V	TGCA	8 cut(s)	67, 219, 299, 557, 578, 764, 809, 971
HpyF10VI	GCNNNNNNNGC	3 cut(s)	132, 239, 470
HpyF3I	CTNAG	2 cut(s)	51, 882
Hsp92II	CATG	3 cut(s)	839, 1007, 1033
Kzo9I	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
LmnI	GCTCC	1 cut(s)	1046
Lsp1109I	GCAGC	4 cut(s)	147, 600, 638, 740
LweI	GCATC	4 cut(s)	544, 547, 600, 865
MaeI	CTAG	1 cut(s)	123
MaeIII	GTNAC	1 cut(s)	7
MalI	GATC	9 cut(s)	318, 455, 515, 544, 714, 801, 866, 936, 966
MboI	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
MboII	GAAGA	4 cut(s)	152, 301, 794, 839
MfeI	CAATTG	1 cut(s)	558
MflI	RGATCY	2 cut(s)	864, 934
MluCI	AATT	5 cut(s)	322, 374, 558, 614, 924
MlyI	GAGTC	1 cut(s)	80
MnlI	CCTC	9 cut(s)	187, 295, 364, 688, 691, 823, 841, 846, 849
MroXI	GAANNNNTTC	1 cut(s)	786
MseI	TTAA	5 cut(s)	117, 402, 423, 620, 768
MslI	CAYNNNNRTG	1 cut(s)	1028
MspA1I	CMGCKG	1 cut(s)	138
MspI	CCGG	1 cut(s)	286
MspR9I	CCNGG	2 cut(s)	495, 861
MunI	CAATTG	1 cut(s)	558
Mva1269I	GAATGC	2 cut(s)	22, 69
MvaI	CCWGG	2 cut(s)	495, 861
MwoI	GCNNNNNNNGC	3 cut(s)	132, 239, 470
NdeII	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
NlaIII	CATG	3 cut(s)	839, 1007, 1033
NlaIV	GGNNCC	2 cut(s)	936, 1048
NmuCI	GTSAC	1 cut(s)	7
NspI	RCATGY	1 cut(s)	1033
PagI	TCATGA	1 cut(s)	1003
PceI	AGGCCT	1 cut(s)	242
PciI	ACATGT	1 cut(s)	1029
PctI	GAATGC	2 cut(s)	22, 69
PdmI	GAANNNNTTC	1 cut(s)	786
PfeI	GAWTC	4 cut(s)	146, 224, 814, 841
PkrI	GCNGC	5 cut(s)	49, 137, 590, 628, 730
PleI	GAGTC	1 cut(s)	79
PpsI	GAGTC	1 cut(s)	79
PpuMI	RGGWCCY	1 cut(s)	196
PscI	ACATGT	1 cut(s)	1029
Psp5II	RGGWCCY	1 cut(s)	196
Psp6I	CCWGG	2 cut(s)	493, 859
PspGI	CCWGG	2 cut(s)	493, 859
PspN4I	GGNNCC	2 cut(s)	936, 1048
PspPI	GGNCC	3 cut(s)	196, 270, 832
PspPPI	RGGWCCY	1 cut(s)	196
PstI	CTGCAG	2 cut(s)	580, 811
PstNI	CAGNNNCTG	1 cut(s)	691
PsuI	RGATCY	2 cut(s)	864, 934
PvuII	CAGCTG	1 cut(s)	138
RsaI	GTAC	1 cut(s)	438
RsaNI	GTAC	1 cut(s)	437
RseI	CAYNNNNRTG	1 cut(s)	1028
SaqAI	TTAA	5 cut(s)	117, 402, 423, 620, 768
SatI	GCNGC	5 cut(s)	48, 136, 589, 627, 729
Sau3AI	GATC	9 cut(s)	316, 453, 513, 542, 712, 799, 864, 934, 964
Sau96I	GGNCC	3 cut(s)	196, 270, 832
ScaI	AGTACT	1 cut(s)	438
SchI	GAGTC	1 cut(s)	80
ScrFI	CCNGG	2 cut(s)	495, 861
SfaNI	GCATC	4 cut(s)	544, 547, 600, 865
SfcI	CTRYAG	2 cut(s)	576, 807
SinI	GGWCC	2 cut(s)	196, 270
SmiMI	CAYNNNNRTG	1 cut(s)	1028
SmlI	CTYRAG	2 cut(s)	386, 1037
SmoI	CTYRAG	2 cut(s)	386, 1037
Sse9I	AATT	5 cut(s)	322, 374, 558, 614, 924
SseBI	AGGCCT	1 cut(s)	242
SsiI	CCGC	2 cut(s)	47, 133
SspMI	CTAG	1 cut(s)	123
StuI	AGGCCT	1 cut(s)	242
StyD4I	CCNGG	2 cut(s)	493, 859
StyI	CCWWGG	2 cut(s)	237, 657
TaaI	ACNGT	3 cut(s)	7, 344, 550
TaqI	TCGA	5 cut(s)	40, 227, 249, 541, 963
TasI	AATT	5 cut(s)	322, 374, 558, 614, 924
TatI	WGTACW	1 cut(s)	436
TauI	GCSGC	1 cut(s)	50
TfiI	GAWTC	4 cut(s)	146, 224, 814, 841
Tru1I	TTAA	5 cut(s)	117, 402, 423, 620, 768
Tru9I	TTAA	5 cut(s)	117, 402, 423, 620, 768
TscAI	CASTG	2 cut(s)	221, 555
TseFI	GTSAC	1 cut(s)	7
TseI	GCWGC	4 cut(s)	135, 588, 626, 728
Tsp45I	GTSAC	1 cut(s)	7
TspRI	CASTG	2 cut(s)	221, 555
VpaK11BI	GGWCC	2 cut(s)	196, 270
XapI	RAATTY	1 cut(s)	924
XceI	RCATGY	1 cut(s)	1033
XcmI	CCANNNNNNNNNTGG	2 cut(s)	360, 664
XmnI	GAANNNNTTC	1 cut(s)	786
XspI	CTAG	1 cut(s)	123
ZrmI	AGTACT	1 cut(s)	438

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.