Rorug05G0544700

ATP-dependent Clp protease proteolytic

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
73312155 .. 73317437
5283 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0544700.1

Sequence Viewer

Length: 261 bp
ATGATAGGATCAACTTATGATGTTCTGCAAGACCAGAGATTTACTTTTACAGGAGATGTAAACACGCATGCTGGTGTGAATAACATTTCACTTCTAAGTGTAGCTGTTGGATTACCGAACAATGGTCCTCACTTTGAGACATGGAACTTCGGAGTACTAGGATCTACAAGGATTGGATCAAGGAAGCAAAGATCTTTGAGTCCTGAGCAGAAGGTGCAAATAATAGAAGAAGAATCAGAAAGTCAAGAATCTCCAAACTGA

Protein Analysis

86

Amino Acids

9.46

Weight (kDa)

4.92

Isoelectric Point (pI)

69.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 16, 169, 184
AfaI GTAC 1 cut(s) 156
AfiI CCNNNNNNNGG 1 cut(s) 122
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
Alw26I GTCTC 1 cut(s) 131
AlwI GGATC 3 cut(s) 16, 169, 184
AspS9I GGNCC 1 cut(s) 125
AvaII GGWCC 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 158
BglII AGATCT 1 cut(s) 191
BmcAI AGTACT 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 125
Bpu10I CCTNAGC 1 cut(s) 204
Bsc4I CCNNNNNNNGG 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 122
BseMII CTCAG 1 cut(s) 195
BslI CCNNNNNNNGG 1 cut(s) 122
BsmAI GTCTC 1 cut(s) 131
Bsp143I GATC 4 cut(s) 8, 161, 176, 191
BspCNI CTCAG 1 cut(s) 196
BspPI GGATC 3 cut(s) 16, 169, 184
BssMI GATC 4 cut(s) 8, 161, 176, 191
BstAPI GCANNNNNTGC 1 cut(s) 214
BstC8I GCNNGC 1 cut(s) 69
BstDEI CTNAG 2 cut(s) 95, 204
BstKTI GATC 4 cut(s) 11, 164, 179, 194
BstMAI GTCTC 1 cut(s) 131
BstMBI GATC 4 cut(s) 8, 161, 176, 191
BstMWI GCNNNNNNNGC 1 cut(s) 214
BstNSI RCATGY 1 cut(s) 71
BstX2I RGATCY 2 cut(s) 161, 191
BstYI RGATCY 2 cut(s) 161, 191
Cac8I GCNNGC 1 cut(s) 69
Cfr13I GGNCC 1 cut(s) 125
Csp6I GTAC 1 cut(s) 155
CviAII CATG 2 cut(s) 68, 141
CviJI RGCY 1 cut(s) 104
CviKI_1 RGCY 1 cut(s) 104
CviQI GTAC 1 cut(s) 155
DdeI CTNAG 2 cut(s) 95, 204
DpnI GATC 4 cut(s) 10, 163, 178, 193
DpnII GATC 4 cut(s) 8, 161, 176, 191
Eco47I GGWCC 1 cut(s) 125
FaeI CATG 2 cut(s) 71, 144
FaiI YATR 3 cut(s) 18, 69, 142
FatI CATG 2 cut(s) 67, 140
FspBI CTAG 1 cut(s) 158
Hin1II CATG 2 cut(s) 71, 144
HinfI GANTC 3 cut(s) 199, 233, 248
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 2 cut(s) 152, 238
Hpy188III TCNNGA 2 cut(s) 203, 245
Hpy8I GTNNAC 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 28, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpyF3I CTNAG 2 cut(s) 95, 204
Hsp92II CATG 2 cut(s) 71, 144
Kzo9I GATC 4 cut(s) 8, 161, 176, 191
LpnPI CCDG 4 cut(s) 36, 47, 57, 216
MaeI CTAG 1 cut(s) 158
MalI GATC 4 cut(s) 10, 163, 178, 193
MboI GATC 4 cut(s) 8, 161, 176, 191
MboII GAAGA 2 cut(s) 239, 242
MflI RGATCY 2 cut(s) 161, 191
MlyI GAGTC 1 cut(s) 208
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 1 cut(s) 138
MslI CAYNNNNRTG 1 cut(s) 72
MwoI GCNNNNNNNGC 1 cut(s) 214
NdeII GATC 4 cut(s) 8, 161, 176, 191
NlaIII CATG 2 cut(s) 71, 144
NspI RCATGY 1 cut(s) 71
PaeI GCATGC 1 cut(s) 71
PfeI GAWTC 2 cut(s) 233, 248
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
PspPI GGNCC 1 cut(s) 125
PsuI RGATCY 2 cut(s) 161, 191
RsaI GTAC 1 cut(s) 156
RsaNI GTAC 1 cut(s) 155
RseI CAYNNNNRTG 1 cut(s) 72
Sau3AI GATC 4 cut(s) 8, 161, 176, 191
Sau96I GGNCC 1 cut(s) 125
ScaI AGTACT 1 cut(s) 156
SchI GAGTC 1 cut(s) 208
SetI ASST 2 cut(s) 106, 216
SinI GGWCC 1 cut(s) 125
SmiMI CAYNNNNRTG 1 cut(s) 72
SphI GCATGC 1 cut(s) 71
SspMI CTAG 1 cut(s) 158
TatI WGTACW 1 cut(s) 154
TfiI GAWTC 2 cut(s) 233, 248
VpaK11BI GGWCC 1 cut(s) 125
XceI RCATGY 1 cut(s) 71
XspI CTAG 1 cut(s) 158
ZrmI AGTACT 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.