Rmu_sc0031303.1_g000001

RNA uridylyltransferase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031303.1
Physical Location & Seq
Reverse (-)
2 .. 325
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031303.1_g000001.1.cds

Sequence Viewer

Length: 206 bp
atggcattgagccgcactgaactgctaaatgaagcaaagagccttgagttacaaggattacagaaatatttgatctctcctctatgtatgcctaaacttgatcaactacttaatgatgtgtatgcggctcgccgtcctaagccaattgattatcgcaatcgaagagatttgattcgtattttcaatgccatctccaaggaattata
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.96

Weight (kDa)

9.58

Isoelectric Point (pI)

63.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 13, 125
AgsI TTSAA 1 cut(s) 184
BccI CCATC 1 cut(s) 197
BceAI ACGGC 1 cut(s) 117
BclI TGATCA 1 cut(s) 100
BisI GCNGC 2 cut(s) 13, 126
BlsI GCNGC 2 cut(s) 14, 127
Bpu10I CCTNAGC 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 195
BseRI GAGGAG 1 cut(s) 69
Bsp143I GATC 2 cut(s) 72, 100
BspACI CCGC 2 cut(s) 13, 125
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 2 cut(s) 72, 100
BssT1I CCWWGG 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 157
BstC8I GCNNGC 1 cut(s) 130
BstDEI CTNAG 1 cut(s) 138
BstKTI GATC 2 cut(s) 75, 103
BstMBI GATC 2 cut(s) 72, 100
BtsIMutI CAGTG 1 cut(s) 15
Cac8I GCNNGC 1 cut(s) 130
CviJI RGCY 4 cut(s) 12, 42, 128, 142
CviKI_1 RGCY 4 cut(s) 12, 42, 128, 142
DdeI CTNAG 1 cut(s) 138
DpnI GATC 2 cut(s) 74, 102
DpnII GATC 2 cut(s) 72, 100
Eam1104I CTCTTC 1 cut(s) 157
EarI CTCTTC 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 195
EcoT14I CCWWGG 1 cut(s) 195
ErhI CCWWGG 1 cut(s) 195
FaiI YATR 4 cut(s) 85, 89, 123, 205
FbaI TGATCA 1 cut(s) 100
Fnu4HI GCNGC 2 cut(s) 13, 126
Fsp4HI GCNGC 2 cut(s) 13, 126
GluI GCNGC 2 cut(s) 13, 126
HinfI GANTC 1 cut(s) 172
HpyF3I CTNAG 1 cut(s) 138
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 2 cut(s) 72, 100
MaeIII GTNAC 1 cut(s) 48
MalI GATC 2 cut(s) 74, 102
MboI GATC 2 cut(s) 72, 100
MboII GAAGA 1 cut(s) 174
MfeI CAATTG 1 cut(s) 144
MluCI AATT 2 cut(s) 144, 200
MnlI CCTC 1 cut(s) 90
MseI TTAA 1 cut(s) 111
MunI CAATTG 1 cut(s) 144
NdeII GATC 2 cut(s) 72, 100
PfeI GAWTC 1 cut(s) 172
PkrI GCNGC 2 cut(s) 14, 127
SaqAI TTAA 1 cut(s) 111
SatI GCNGC 2 cut(s) 13, 126
Sau3AI GATC 2 cut(s) 72, 100
SgeI CNNG 4 cut(s) 56, 65, 110, 141
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 2 cut(s) 144, 200
SsiI CCGC 2 cut(s) 13, 125
SspI AATATT 1 cut(s) 68
StyI CCWWGG 1 cut(s) 195
TaqI TCGA 1 cut(s) 160
TasI AATT 2 cut(s) 144, 200
TauI GCSGC 2 cut(s) 15, 128
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TscAI CASTG 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 45
TspRI CASTG 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.