Rmu_sc0031952.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031952.1
Physical Location & Seq
Forward (+)
1460 .. 2053
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031952.1_g000002.1.cds

Sequence Viewer

Length: 594 bp
atgacgaggagttcgaggcacaaatcgagtaagcacagggaggtgagggagtactcggattcggagaaggattcgagcttgaaagatcggaaggagagtggcggaggaggagctagggtttcgagtgagaagaggaagctggatttgaaggaggggaaggagtctgggaatggggagtacgcggaggagctagggtcgtcgaagcggcggaaggagagggttgtggatgatggagggagtgataggtggaatggtggggagtatgagcacagaggaggaagtggagaggggtcgaagaaggcggtgaagggttcgggggattcgaagagtaggaagagagatgggagtgtggaaatgtatggggagggtggtgaggggaagaagagtggtagtagtggtgggaagggtgaagggaagcatagggatagggataaggattcgagtcgaaaggagggcggtggagtggagagggagaaggatagggagagggagaagaaaagtaaagatgggagaagtgagagattgggaagtggcggcgacgaacaacggctggtggcaaagcaagggaatgaaaatactggtaaggtaacttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

197

Amino Acids

21.44

Weight (kDa)

9.59

Isoelectric Point (pI)

43.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 182
AciI CCGC 7 cut(s) 102, 182, 205, 208, 302, 456, 534
AfaI GTAC 2 cut(s) 53, 179
AgsI TTSAA 2 cut(s) 82, 148
AluBI AGCT 4 cut(s) 78, 113, 139, 190
AluI AGCT 4 cut(s) 78, 113, 139, 190
Alw21I GWGCWC 1 cut(s) 270
ArsI GACNNNNNNTTYG 1 cut(s) 27
AsuHPI GGTGA 4 cut(s) 55, 316, 383, 419
AsuII TTCGAA 1 cut(s) 323
Bbv12I GWGCWC 1 cut(s) 270
BccI CCATC 3 cut(s) 224, 335, 500
BceAI ACGGC 1 cut(s) 563
BfaI CTAG 2 cut(s) 114, 191
BisI GCNGC 2 cut(s) 206, 535
BlsI GCNGC 2 cut(s) 207, 536
BmcAI AGTACT 1 cut(s) 53
Bpu14I TTCGAA 1 cut(s) 323
BsaXI ACNNNNNCTCC 4 cut(s) 102, 132, 179, 209
Bse1I ACTGG 1 cut(s) 583
BseGI GGATG 1 cut(s) 232
BseNI ACTGG 1 cut(s) 583
BseRI GAGGAG 5 cut(s) 22, 120, 123, 200, 288
Bsh1236I CGCG 1 cut(s) 182
BsiHKAI GWGCWC 1 cut(s) 270
Bsp119I TTCGAA 1 cut(s) 323
Bsp1286I GDGCHC 1 cut(s) 270
Bsp143I GATC 1 cut(s) 85
BspACI CCGC 7 cut(s) 102, 182, 205, 208, 302, 456, 534
BspFNI CGCG 1 cut(s) 182
BspT104I TTCGAA 1 cut(s) 323
BsrI ACTGG 1 cut(s) 583
BssMI GATC 1 cut(s) 85
Bst6I CTCTTC 4 cut(s) 125, 320, 329, 377
BstBI TTCGAA 1 cut(s) 323
BstF5I GGATG 1 cut(s) 232
BstFNI CGCG 1 cut(s) 182
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstUI CGCG 1 cut(s) 182
BtsCI GGATG 1 cut(s) 232
Csp6I GTAC 2 cut(s) 52, 178
CviJI RGCY 5 cut(s) 78, 113, 139, 190, 550
CviKI_1 RGCY 5 cut(s) 78, 113, 139, 190, 550
CviQI GTAC 2 cut(s) 52, 178
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eam1104I CTCTTC 4 cut(s) 125, 320, 329, 377
EarI CTCTTC 4 cut(s) 125, 320, 329, 377
EciI GGCGGA 2 cut(s) 117, 223
FaiI YATR 3 cut(s) 264, 360, 420
Fnu4HI GCNGC 2 cut(s) 206, 535
FokI GGATG 1 cut(s) 239
Fsp4HI GCNGC 2 cut(s) 206, 535
FspBI CTAG 2 cut(s) 114, 191
GluI GCNGC 2 cut(s) 206, 535
HinfI GANTC 6 cut(s) 59, 71, 161, 320, 437, 442
HphI GGTGA 4 cut(s) 55, 316, 383, 419
Hpy188I TCNGA 3 cut(s) 58, 64, 90
Hpy99I CGWCG 2 cut(s) 202, 542
Kzo9I GATC 1 cut(s) 85
LmnI GCTCC 2 cut(s) 110, 187
LpnPI CCDG 5 cut(s) 22, 125, 150, 536, 564
MaeI CTAG 2 cut(s) 114, 191
MaeIII GTNAC 1 cut(s) 586
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 7 cut(s) 142, 307, 337, 346, 391, 394, 505
MhlI GDGCHC 1 cut(s) 270
MlyI GAGTC 2 cut(s) 170, 451
MseI TTAA 1 cut(s) 592
MvnI CGCG 1 cut(s) 182
NdeII GATC 1 cut(s) 85
NspV TTCGAA 1 cut(s) 323
PcsI WCGNNNNNNNCGW 2 cut(s) 11, 320
PfeI GAWTC 4 cut(s) 59, 71, 320, 437
PkrI GCNGC 2 cut(s) 207, 536
PleI GAGTC 2 cut(s) 169, 450
PpsI GAGTC 2 cut(s) 169, 450
RsaI GTAC 2 cut(s) 53, 179
RsaNI GTAC 2 cut(s) 52, 178
SaqAI TTAA 1 cut(s) 592
SatI GCNGC 2 cut(s) 206, 535
Sau3AI GATC 1 cut(s) 85
ScaI AGTACT 1 cut(s) 53
SchI GAGTC 2 cut(s) 170, 451
SduI GDGCHC 1 cut(s) 270
SetI ASST 7 cut(s) 45, 80, 115, 141, 192, 248, 588
SfuI TTCGAA 1 cut(s) 323
SsiI CCGC 7 cut(s) 102, 182, 205, 208, 302, 456, 534
SspMI CTAG 2 cut(s) 114, 191
TaqI TCGA 9 cut(s) 14, 26, 74, 122, 200, 293, 323, 440, 445
TatI WGTACW 1 cut(s) 51
TauI GCSGC 2 cut(s) 208, 537
TfiI GAWTC 4 cut(s) 59, 71, 320, 437
Tru1I TTAA 1 cut(s) 592
Tru9I TTAA 1 cut(s) 592
TspDTI ATGAA 1 cut(s) 585
XspI CTAG 2 cut(s) 114, 191
ZrmI AGTACT 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.