Rmu_sc0032608.1_g000001

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032608.1
Physical Location & Seq
Reverse (-)
776 .. 1928
1153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032608.1_g000001.1.cds

Sequence Viewer

Length: 363 bp
atggatgcatacagacttcagttgaaacttttcctttatgaagtgaagcagcaacagttattatctggtgttaggaccttcttaaaagtctattcatccatctctcttgggaaccttgcgaagtacatggaagtggatgaatccaagttgaggactatcttgctgacatacaaacacaagacacatgcagttgacactgatggaaaaaccatttccaatgctgatgtggatttttatatgaacgatgattgggtttatgttgttgactcgaaaccaccaaaacgatatggggattacttcttgcgtcagatagtgaagcttgaaggggcaatcaacgatctggacaggataaagctggattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

14.05

Weight (kDa)

7.86

Isoelectric Point (pI)

23.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 2 cut(s) 25, 323
AluBI AGCT 2 cut(s) 319, 355
AluI AGCT 2 cut(s) 319, 355
ApeKI GCWGC 1 cut(s) 49
Asp700I GAANNNNTTC 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 75
AvaII GGWCC 1 cut(s) 75
BbvI GCAGC 1 cut(s) 61
BccI CCATC 2 cut(s) 107, 194
BisI GCNGC 1 cut(s) 50
BlsI GCNGC 1 cut(s) 51
Bme18I GGWCC 1 cut(s) 75
BmgT120I GGNCC 1 cut(s) 75
BmiI GGNNCC 1 cut(s) 113
Bsc4I CCNNNNNNNGG 1 cut(s) 150
BseGI GGATG 3 cut(s) 10, 95, 142
BseLI CCNNNNNNNGG 1 cut(s) 150
BseXI GCAGC 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 150
Bsp143I GATC 1 cut(s) 337
BspLI GGNNCC 1 cut(s) 113
BssMI GATC 1 cut(s) 337
Bst4CI ACNGT 1 cut(s) 57
BstF5I GGATG 3 cut(s) 10, 95, 142
BstKTI GATC 1 cut(s) 340
BstMBI GATC 1 cut(s) 337
BstNSI RCATGY 1 cut(s) 188
BstV1I GCAGC 1 cut(s) 61
BtsCI GGATG 3 cut(s) 10, 95, 142
BtsIMutI CAGTG 1 cut(s) 195
Cfr13I GGNCC 1 cut(s) 75
CseI GACGC 1 cut(s) 293
Csp6I GTAC 1 cut(s) 124
CviAII CATG 2 cut(s) 127, 185
CviJI RGCY 2 cut(s) 319, 355
CviKI_1 RGCY 2 cut(s) 319, 355
CviQI GTAC 1 cut(s) 124
DpnI GATC 1 cut(s) 339
DpnII GATC 1 cut(s) 337
Eco47I GGWCC 1 cut(s) 75
EcoO109I RGGNCCY 1 cut(s) 75
EcoT22I ATGCAT 1 cut(s) 10
FaeI CATG 2 cut(s) 130, 188
FaiI YATR 9 cut(s) 10, 39, 128, 169, 186, 237, 239, 258, 288
FatI CATG 2 cut(s) 126, 184
Fnu4HI GCNGC 1 cut(s) 50
FokI GGATG 3 cut(s) 17, 82, 149
Fsp4HI GCNGC 1 cut(s) 50
GluI GCNGC 1 cut(s) 50
HgaI GACGC 1 cut(s) 293
Hin1II CATG 2 cut(s) 130, 188
HincII GTYRAC 2 cut(s) 193, 265
HindII GTYRAC 2 cut(s) 193, 265
HindIII AAGCTT 1 cut(s) 317
HinfI GANTC 2 cut(s) 140, 266
Hpy166II GTNNAC 2 cut(s) 193, 265
Hpy188I TCNGA 1 cut(s) 309
Hpy188III TCNNGA 1 cut(s) 341
Hpy8I GTNNAC 2 cut(s) 193, 265
HpyAV CCTTC 2 cut(s) 88, 317
HpyCH4III ACNGT 1 cut(s) 57
HpyCH4V TGCA 2 cut(s) 8, 188
Hsp92II CATG 2 cut(s) 130, 188
Kzo9I GATC 1 cut(s) 337
LpnPI CCDG 4 cut(s) 51, 326, 331, 341
Lsp1109I GCAGC 1 cut(s) 61
MalI GATC 1 cut(s) 339
MboI GATC 1 cut(s) 337
MlyI GAGTC 1 cut(s) 260
MnlI CCTC 1 cut(s) 144
Mph1103I ATGCAT 1 cut(s) 10
MroXI GAANNNNTTC 1 cut(s) 29
MseI TTAA 1 cut(s) 83
MslI CAYNNNNRTG 1 cut(s) 131
NdeII GATC 1 cut(s) 337
NlaIII CATG 2 cut(s) 130, 188
NlaIV GGNNCC 1 cut(s) 113
NsiI ATGCAT 1 cut(s) 10
NspI RCATGY 1 cut(s) 188
PdmI GAANNNNTTC 1 cut(s) 29
PfeI GAWTC 1 cut(s) 140
PkrI GCNGC 1 cut(s) 51
PleI GAGTC 1 cut(s) 260
PpsI GAGTC 1 cut(s) 260
PpuMI RGGWCCY 1 cut(s) 75
Psp5II RGGWCCY 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 113
PspPI GGNCC 1 cut(s) 75
PspPPI RGGWCCY 1 cut(s) 75
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
RseI CAYNNNNRTG 1 cut(s) 131
SaqAI TTAA 1 cut(s) 83
SatI GCNGC 1 cut(s) 50
Sau3AI GATC 1 cut(s) 337
Sau96I GGNCC 1 cut(s) 75
SchI GAGTC 1 cut(s) 260
SetI ASST 4 cut(s) 80, 117, 321, 357
SinI GGWCC 1 cut(s) 75
SmiMI CAYNNNNRTG 1 cut(s) 131
TaaI ACNGT 1 cut(s) 57
TaqI TCGA 1 cut(s) 269
TatI WGTACW 1 cut(s) 123
TfiI GAWTC 1 cut(s) 140
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TscAI CASTG 1 cut(s) 202
TseI GCWGC 1 cut(s) 49
TspDTI ATGAA 4 cut(s) 54, 84, 153, 254
TspRI CASTG 1 cut(s) 202
VpaK11BI GGWCC 1 cut(s) 75
XceI RCATGY 1 cut(s) 188
XcmI CCANNNNNNNNNTGG 1 cut(s) 223
XmnI GAANNNNTTC 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.