Rmu_sc0033550.1_g000001

Protein LTV1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033550.1
Physical Location & Seq
Reverse (-)
2 .. 505
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033550.1_g000001.1.cds

Sequence Viewer

Length: 378 bp
acggtcaatgtgagggttaagaaagctgttgatccggaagtttctgcattgcttgatgctgatagcgatgcttcgctgttcggttctgatgatgaggatttggaagaggattttgtggttaaggctaaccttgctgatggagatgaagaggaggatgtgtgtgtaggtgatgggccaagttttgttgagcaatcggagaacaacaatgcaaggaatgaagttggtgtggttggaagaaattgcgtggagagaggaaagggtgactttgtggtagatgatccacgagctcgtcgggatgtggatgcagaatttgatatggttttaagtcgggaatatgacaatgacgatgatgatgacgactatgaaggtggtgatcat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

13.83

Weight (kDa)

4.05

Isoelectric Point (pI)

31.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 34
AclWI GGATC 2 cut(s) 26, 272
AcsI RAATTY 1 cut(s) 308
AluBI AGCT 2 cut(s) 26, 287
AluI AGCT 2 cut(s) 26, 287
Alw21I GWGCWC 1 cut(s) 289
AlwI GGATC 2 cut(s) 26, 272
Aor13HI TCCGGA 1 cut(s) 34
AoxI GGCC 1 cut(s) 173
ApoI RAATTY 1 cut(s) 308
AspS9I GGNCC 1 cut(s) 173
AsuHPI GGTGA 2 cut(s) 179, 272
BanII GRGCYC 1 cut(s) 289
BauI CACGAG 1 cut(s) 282
Bbv12I GWGCWC 1 cut(s) 289
BccI CCATC 2 cut(s) 131, 164
BclI TGATCA 1 cut(s) 373
BmgT120I GGNCC 1 cut(s) 173
BmsI GCATC 3 cut(s) 46, 58, 292
BsaWI WCCGGW 1 cut(s) 34
BsaXI ACNNNNNCTCC 2 cut(s) 143, 173
Bse3DI GCAATG 1 cut(s) 47
BseAI TCCGGA 1 cut(s) 34
BseGI GGATG 3 cut(s) 160, 301, 307
BseMI GCAATG 1 cut(s) 47
BseRI GAGGAG 1 cut(s) 164
BshFI GGCC 1 cut(s) 175
BsiHKAI GWGCWC 1 cut(s) 289
BsiSI CCGG 1 cut(s) 35
BsnI GGCC 1 cut(s) 175
Bsp1286I GDGCHC 1 cut(s) 289
Bsp13I TCCGGA 1 cut(s) 34
Bsp143I GATC 3 cut(s) 31, 277, 373
BspANI GGCC 1 cut(s) 175
BspEI TCCGGA 1 cut(s) 34
BspPI GGATC 2 cut(s) 26, 272
BsrDI GCAATG 1 cut(s) 47
BssMI GATC 3 cut(s) 31, 277, 373
BssSI CACGAG 1 cut(s) 282
Bst2BI CACGAG 1 cut(s) 282
Bst4CI ACNGT 1 cut(s) 4
Bst6I CTCTTC 2 cut(s) 99, 141
BstF5I GGATG 3 cut(s) 160, 301, 307
BstKTI GATC 3 cut(s) 34, 280, 376
BstMBI GATC 3 cut(s) 31, 277, 373
BstMWI GCNNNNNNNGC 1 cut(s) 131
BsuRI GGCC 1 cut(s) 175
BtgZI GCGATG 1 cut(s) 81
BtsCI GGATG 3 cut(s) 160, 301, 307
Cfr13I GGNCC 1 cut(s) 173
CviJI RGCY 4 cut(s) 26, 125, 175, 287
CviKI_1 RGCY 4 cut(s) 26, 125, 175, 287
DpnI GATC 3 cut(s) 33, 279, 375
DpnII GATC 3 cut(s) 31, 277, 373
Eam1104I CTCTTC 2 cut(s) 99, 141
EarI CTCTTC 2 cut(s) 99, 141
Ecl136II GAGCTC 1 cut(s) 287
Eco24I GRGCYC 1 cut(s) 289
Eco53kI GAGCTC 1 cut(s) 287
EcoICRI GAGCTC 1 cut(s) 287
EcoT38I GRGCYC 1 cut(s) 289
FaiI YATR 3 cut(s) 317, 336, 363
FalI AAGNNNNNCTT 2 cut(s) 248, 280
FbaI TGATCA 1 cut(s) 373
FokI GGATG 3 cut(s) 167, 308, 314
FriOI GRGCYC 1 cut(s) 289
HaeIII GGCC 1 cut(s) 175
HapII CCGG 1 cut(s) 35
HpaII CCGG 1 cut(s) 35
HphI GGTGA 2 cut(s) 179, 272
Hpy188I TCNGA 2 cut(s) 88, 196
Hpy188III TCNNGA 3 cut(s) 35, 293, 329
Hpy99I CGWCG 1 cut(s) 294
HpyAV CCTTC 1 cut(s) 359
HpyCH4III ACNGT 1 cut(s) 4
HpyCH4V TGCA 3 cut(s) 47, 209, 305
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
Kpn2I TCCGGA 1 cut(s) 34
Ksp22I TGATCA 1 cut(s) 373
Kzo9I GATC 3 cut(s) 31, 277, 373
LpnPI CCDG 1 cut(s) 48
LweI GCATC 3 cut(s) 46, 58, 292
MaeIII GTNAC 1 cut(s) 260
MalI GATC 3 cut(s) 33, 279, 375
MboI GATC 3 cut(s) 31, 277, 373
MboII GAAGA 3 cut(s) 116, 158, 246
MhlI GDGCHC 1 cut(s) 289
MluCI AATT 2 cut(s) 238, 308
MmeI TCCRAC 1 cut(s) 211
MnlI CCTC 6 cut(s) 6, 88, 100, 142, 145, 245
MroI TCCGGA 1 cut(s) 34
MseI TTAA 3 cut(s) 18, 120, 323
MspI CCGG 1 cut(s) 35
MwoI GCNNNNNNNGC 1 cut(s) 131
NdeII GATC 3 cut(s) 31, 277, 373
NmuCI GTSAC 1 cut(s) 260
Psp124BI GAGCTC 1 cut(s) 289
PspPI GGNCC 1 cut(s) 173
SacI GAGCTC 1 cut(s) 289
SaqAI TTAA 3 cut(s) 18, 120, 323
Sau3AI GATC 3 cut(s) 31, 277, 373
Sau96I GGNCC 1 cut(s) 173
SduI GDGCHC 1 cut(s) 289
SetI ASST 5 cut(s) 28, 132, 169, 289, 370
SfaNI GCATC 3 cut(s) 46, 58, 292
Sse9I AATT 2 cut(s) 238, 308
SstI GAGCTC 1 cut(s) 289
TaaI ACNGT 1 cut(s) 4
TasI AATT 2 cut(s) 238, 308
Tru1I TTAA 3 cut(s) 18, 120, 323
Tru9I TTAA 3 cut(s) 18, 120, 323
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
TspDTI ATGAA 3 cut(s) 159, 231, 378
XapI RAATTY 1 cut(s) 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.